Mutagenetix > Incidental Mutations

Incidental Mutation 'R7424:Kif1a'

575887

Institutional Source

Beutler Lab

Gene Symbol

Kif1a

Ensembl Gene

ENSMUSG00000014602

Gene Name

kinesin family member 1A

Synonyms

LOC381283, N-3 kinesin, ATSV, C630002N23Rik, Kns1

MMRRC Submission

Accession Numbers

Genbank: NM_008440.3, NM_001110315.1

Is this an essential gene?

Probably essential (E-score: 0.854) question?

Stock #

R7424 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

93015464-93101951 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 93054317 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 787 (V787E)

Ref Sequence

ENSEMBL: ENSMUSP00000128432 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086819] [ENSMUST00000112958] [ENSMUST00000171556] [ENSMUST00000171796] [ENSMUST00000190723]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000086819
AA Change: V796E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000084029
Gene: ENSMUSG00000014602
AA Change: V796E

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	411	429	N/A	INTRINSIC
FHA	524	581	1.39e-8	SMART
coiled coil region	634	688	N/A	INTRINSIC
low complexity region	693	706	N/A	INTRINSIC
low complexity region	762	778	N/A	INTRINSIC
Pfam:KIF1B	814	861	6.4e-13	PFAM
Pfam:DUF3694	1157	1305	1.8e-47	PFAM
low complexity region	1420	1444	N/A	INTRINSIC
low complexity region	1541	1549	N/A	INTRINSIC
PH	1584	1683	1.52e-13	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112958
AA Change: V787E

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000108582
Gene: ENSMUSG00000014602
AA Change: V787E

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	402	420	N/A	INTRINSIC
FHA	515	572	1.39e-8	SMART
coiled coil region	625	679	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
low complexity region	753	769	N/A	INTRINSIC
Pfam:KIF1B	805	851	3.9e-15	PFAM
Pfam:DUF3694	1148	1304	5e-40	PFAM
low complexity region	1420	1444	N/A	INTRINSIC
low complexity region	1541	1549	N/A	INTRINSIC
PH	1584	1683	1.52e-13	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171556
AA Change: V787E

PolyPhen 2 Score 0.600 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000130717
Gene: ENSMUSG00000014602
AA Change: V787E

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	402	420	N/A	INTRINSIC
FHA	515	572	1.39e-8	SMART
coiled coil region	625	679	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
low complexity region	753	769	N/A	INTRINSIC
Pfam:KIF1B	805	852	2.7e-13	PFAM
Pfam:DUF3694	1148	1296	8.4e-48	PFAM
low complexity region	1411	1435	N/A	INTRINSIC
low complexity region	1532	1540	N/A	INTRINSIC
PH	1575	1674	1.52e-13	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171796
AA Change: V787E

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000128432
Gene: ENSMUSG00000014602
AA Change: V787E

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	402	420	N/A	INTRINSIC
FHA	515	572	1.39e-8	SMART
coiled coil region	625	679	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
low complexity region	753	769	N/A	INTRINSIC
Pfam:KIF1B	805	852	6.4e-13	PFAM
Pfam:DUF3694	1148	1304	1.8e-46	PFAM
low complexity region	1419	1443	N/A	INTRINSIC
low complexity region	1540	1548	N/A	INTRINSIC
PH	1583	1682	1.52e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000186828

Predicted Effect

possibly damaging
Transcript: ENSMUST00000190723
AA Change: V796E

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000140163
Gene: ENSMUSG00000014602
AA Change: V796E

Domain	Start	End	E-Value	Type
KISc	3	362	5.2e-180	SMART
low complexity region	411	429	N/A	INTRINSIC
coiled coil region	438	471	N/A	INTRINSIC
FHA	524	581	6.9e-11	SMART
coiled coil region	634	688	N/A	INTRINSIC
low complexity region	693	706	N/A	INTRINSIC
low complexity region	762	778	N/A	INTRINSIC
Pfam:KIF1B	814	861	4e-10	PFAM
low complexity region	885	900	N/A	INTRINSIC
coiled coil region	901	929	N/A	INTRINSIC
internal_repeat_1	938	957	5.9e-5	PROSPERO
Pfam:DUF3694	1250	1398	1.1e-44	PFAM
low complexity region	1513	1537	N/A	INTRINSIC
low complexity region	1634	1642	N/A	INTRINSIC
PH	1677	1776	6.9e-16	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

99% (76/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kinesin family and functions as an anterograde motor protein that transports membranous organelles along axonal microtubules. Mutations at this locus have been associated with spastic paraplegia-30 and hereditary sensory neuropathy IIC. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Apr 2012]
PHENOTYPE: Most mice homozygous for a null allele die within a day of birth, with reduced motor and sensory deficits, decreased synaptic vesicle precursor transport, and significant neuronal degeneration in the central nervous system, but two point mutant alleles cause progressive hindleg paralysis [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430548M08Rik	C	T	8: 120,145,545	R71C	probably damaging	Het
Aanat	A	T	11: 116,595,629		probably benign	Het
Ahrr	G	T	13: 74,257,545	S91*	probably null	Het
Ampd1	A	T	3: 103,088,442	N223Y	probably benign	Het
Ankar	T	G	1: 72,680,058	N544T	probably damaging	Het
Ankk1	A	G	9: 49,418,750	S302P	possibly damaging	Het
Bcr	T	C	10: 75,157,100	V809A	probably benign	Het
Bpifb2	A	G	2: 153,890,540	N353S	possibly damaging	Het
Cyth1	A	T	11: 118,184,009		probably null	Het
Ddx5	A	T	11: 106,782,180	N506K	probably benign	Het
Dnaja1	A	T	4: 40,730,244	I239F	probably benign	Het
Ethe1	C	T	7: 24,606,251	T141I	probably damaging	Het
Fam160b2	T	C	14: 70,594,007	H29R	probably damaging	Het
Gdap2	A	T	3: 100,202,066	I36F	unknown	Het
Gm13030	A	T	4: 138,871,266	D115E	unknown	Het
Gm13103	C	T	4: 143,853,209	P455S	probably benign	Het
Gm17019	A	T	5: 15,029,372	L227Q	probably damaging	Het
Gm9195	T	A	14: 72,435,777	E2517D	possibly damaging	Het
Gramd2	T	A	9: 59,708,071	V39D	possibly damaging	Het
Hmcn1	C	T	1: 150,630,266	W3836*	probably null	Het
Hspa14	C	T	2: 3,489,041	D494N	possibly damaging	Het
Ifit2	A	G	19: 34,573,198	N46S	probably benign	Het
Ifna6	A	T	4: 88,827,807	E131V	possibly damaging	Het
Ift140	T	C	17: 25,037,036	V504A	possibly damaging	Het
Irgc1	T	C	7: 24,432,228	N388S	probably damaging	Het
Itgal	T	A	7: 127,317,365	V743E	probably benign	Het
Itih5	T	C	2: 10,245,637	S716P	probably damaging	Het
Kcnab1	A	T	3: 65,266,503	K78N	possibly damaging	Het
Krt15	A	T	11: 100,135,560	V100E	possibly damaging	Het
Krt39	A	T	11: 99,518,091	V293E	probably damaging	Het
Lrrn4	A	G	2: 132,869,743	F720S	possibly damaging	Het
Map2	G	A	1: 66,414,824	A958T	possibly damaging	Het
Map3k9	A	G	12: 81,724,097	S906P	probably benign	Het
Mdc1	T	C	17: 35,853,309	S1250P	probably benign	Het
Meltf	G	A	16: 31,884,946	V164I	probably damaging	Het
Mtap	T	G	4: 89,179,462		probably null	Het
Mtus1	C	A	8: 41,022,406	V184F	probably damaging	Het
Myh1	A	T	11: 67,213,663	D1015V	probably damaging	Het
Ndrg1	T	C	15: 66,944,938		probably null	Het
Nkd1	G	T	8: 88,585,175	V130L	probably benign	Het
Nsfl1c	A	G	2: 151,500,753	D81G	probably benign	Het
Nt5c1b	T	A	12: 10,381,391		probably null	Het
Nucb1	T	C	7: 45,498,778	K204E	possibly damaging	Het
Nwd1	T	G	8: 72,675,173	M774R	possibly damaging	Het
Olfr165	A	T	16: 19,407,194	V274E	probably damaging	Het
Olfr262	A	T	19: 12,240,954	S236T	possibly damaging	Het
Olfr654	G	C	7: 104,588,700	E299Q	probably damaging	Het
Pan3	T	A	5: 147,536,272		probably null	Het
Pcdh15	A	T	10: 74,506,485	T1135S	probably benign	Het
Pfas	A	G	11: 69,000,092	I331T	probably damaging	Het
Plxna2	T	A	1: 194,806,339	I1641N	probably damaging	Het
Ptar1	A	T	19: 23,718,101	R311W	probably damaging	Het
Ranbp2	T	G	10: 58,479,194	M1912R	probably damaging	Het
Rbm12	A	G	2: 156,097,303	F350L	possibly damaging	Het
Sdhaf1	T	C	7: 30,322,043	D96G	probably benign	Het
Serpinb6b	T	A	13: 32,968,667	M53K	probably damaging	Het
Sh2d6	A	T	6: 72,517,164	L147Q	probably benign	Het
Slc19a2	T	A	1: 164,260,876	C298S	probably benign	Het
Son	AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG	AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG	16: 91,660,334		probably benign	Het
St8sia2	T	A	7: 73,960,902	Q211L	possibly damaging	Het
Sult2a2	T	C	7: 13,734,897	I96T	possibly damaging	Het
Tab2	G	T	10: 7,907,483	H678Q	probably damaging	Het
Tnfaip6	A	G	2: 52,038,216	E14G	probably benign	Het
Trip11	A	T	12: 101,885,198	L869H	probably damaging	Het
Tslp	T	C	18: 32,819,080	Y133H	not run	Het
Ttn	A	G	2: 76,932,143	V3374A	unknown	Het
Ttn	T	C	2: 76,740,990	I26520V	probably damaging	Het
Tubgcp2	T	A	7: 140,007,924	I263F	possibly damaging	Het
Uaca	A	G	9: 60,870,110	E593G	probably damaging	Het
Unc13b	C	T	4: 43,172,235	T1021I	unknown	Het
Ush1c	T	A	7: 46,225,555	I131F	probably benign	Het
Usp24	C	A	4: 106,379,107	D997E	probably benign	Het
Usp54	T	C	14: 20,577,040	T517A	probably benign	Het
Vmn1r151	A	T	7: 22,499,080	M200K	possibly damaging	Het
Vmn2r43	T	C	7: 8,255,329	D295G	probably damaging	Het
Vmn2r70	G	A	7: 85,563,868	P444S	probably damaging	Het
Vmn2r85	G	T	10: 130,418,980	P612T	probably damaging	Het
Vps13d	A	T	4: 145,148,747	V1736D		Het
Zbtb11	A	T	16: 55,990,487	H336L	probably benign	Het

Other mutations in Kif1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00230:Kif1a	APN	1	93054934	missense	probably damaging	1.00
IGL01574:Kif1a	APN	1	93082340	missense	probably damaging	1.00
IGL01637:Kif1a	APN	1	93039853	missense	possibly damaging	0.95
IGL01895:Kif1a	APN	1	93025733	missense	possibly damaging	0.65
IGL02215:Kif1a	APN	1	93020549	missense	probably benign	0.05
IGL02571:Kif1a	APN	1	93020456	critical splice donor site	probably null
IGL02734:Kif1a	APN	1	93062558	missense	probably damaging	1.00
IGL02752:Kif1a	APN	1	93039847	missense	possibly damaging	0.92
IGL02990:Kif1a	APN	1	93039263	missense	probably damaging	1.00
IGL03298:Kif1a	APN	1	93066181	missense	probably damaging	1.00
IGL03309:Kif1a	APN	1	93058857	nonsense	probably null
IGL03354:Kif1a	APN	1	93060235	missense	probably damaging	1.00
asbestos	UTSW	1	93022505	missense	probably damaging	1.00
chrysolite	UTSW	1	93074948	splice site	probably benign
osmium	UTSW	1	93058810	splice site	probably benign
R4538_Kif1a_397	UTSW	1	93077047	missense	probably damaging	1.00
1mM(1):Kif1a	UTSW	1	93077068	missense	probably benign	0.00
IGL03046:Kif1a	UTSW	1	93082406	missense	probably damaging	1.00
PIT4508001:Kif1a	UTSW	1	93046729	missense	probably damaging	1.00
R0025:Kif1a	UTSW	1	93042358	missense	probably damaging	1.00
R0115:Kif1a	UTSW	1	93046778	splice site	probably benign
R0243:Kif1a	UTSW	1	93042093	missense	probably damaging	1.00
R0270:Kif1a	UTSW	1	93054442	splice site	probably benign
R0335:Kif1a	UTSW	1	93052566	splice site	probably benign
R0380:Kif1a	UTSW	1	93056031	critical splice acceptor site	probably null
R0472:Kif1a	UTSW	1	93018997	missense	probably damaging	0.99
R0501:Kif1a	UTSW	1	93056245	missense	probably damaging	1.00
R0538:Kif1a	UTSW	1	93043638	missense	probably damaging	0.99
R0628:Kif1a	UTSW	1	93019883	missense	probably damaging	1.00
R0848:Kif1a	UTSW	1	93019898	missense	probably damaging	1.00
R1110:Kif1a	UTSW	1	93023453	splice site	probably benign
R1132:Kif1a	UTSW	1	93056021	missense	probably damaging	0.99
R1387:Kif1a	UTSW	1	93055950	splice site	probably benign
R1466:Kif1a	UTSW	1	93054929	missense	possibly damaging	0.68
R1466:Kif1a	UTSW	1	93054929	missense	possibly damaging	0.68
R1544:Kif1a	UTSW	1	93074948	splice site	probably benign
R1569:Kif1a	UTSW	1	93058810	splice site	probably benign
R1802:Kif1a	UTSW	1	93066149	missense	probably damaging	1.00
R1917:Kif1a	UTSW	1	93019031	missense	possibly damaging	0.95
R1919:Kif1a	UTSW	1	93019031	missense	possibly damaging	0.95
R1999:Kif1a	UTSW	1	93060795	missense	probably damaging	0.98
R2000:Kif1a	UTSW	1	93054329	missense	probably damaging	0.99
R2276:Kif1a	UTSW	1	93068477	splice site	probably benign
R2307:Kif1a	UTSW	1	93078769	missense	probably damaging	1.00
R2919:Kif1a	UTSW	1	93046742	missense	probably damaging	1.00
R3440:Kif1a	UTSW	1	93036853	missense	possibly damaging	0.53
R3441:Kif1a	UTSW	1	93036853	missense	possibly damaging	0.53
R3618:Kif1a	UTSW	1	93077043	missense	probably null	1.00
R3957:Kif1a	UTSW	1	93025694	missense	probably damaging	1.00
R4010:Kif1a	UTSW	1	93022409	missense	probably benign	0.42
R4013:Kif1a	UTSW	1	93076292	missense	probably damaging	1.00
R4017:Kif1a	UTSW	1	93076292	missense	probably damaging	1.00
R4115:Kif1a	UTSW	1	93052538	missense	probably damaging	1.00
R4386:Kif1a	UTSW	1	93068550	missense	probably damaging	1.00
R4538:Kif1a	UTSW	1	93077047	missense	probably damaging	1.00
R4608:Kif1a	UTSW	1	93024646	missense	possibly damaging	0.81
R4625:Kif1a	UTSW	1	93042659	missense	probably benign	0.00
R4701:Kif1a	UTSW	1	93078835	missense	probably damaging	0.99
R4794:Kif1a	UTSW	1	93025727	missense	probably damaging	1.00
R4830:Kif1a	UTSW	1	93021209	splice site	probably null
R4903:Kif1a	UTSW	1	93021734	missense	probably damaging	1.00
R4915:Kif1a	UTSW	1	93074978	missense	probably benign	0.21
R4918:Kif1a	UTSW	1	93074978	missense	probably benign	0.21
R4991:Kif1a	UTSW	1	93078808	missense	probably benign	0.00
R5028:Kif1a	UTSW	1	93054327	missense	possibly damaging	0.68
R5051:Kif1a	UTSW	1	93076154	splice site	probably null
R5073:Kif1a	UTSW	1	93022505	missense	probably damaging	1.00
R5103:Kif1a	UTSW	1	93046696	missense	probably damaging	1.00
R5314:Kif1a	UTSW	1	93018498	missense	probably damaging	1.00
R5481:Kif1a	UTSW	1	93060244	missense	probably benign	0.01
R5510:Kif1a	UTSW	1	93041692	missense	possibly damaging	0.93
R5610:Kif1a	UTSW	1	93025728	missense	probably damaging	1.00
R5643:Kif1a	UTSW	1	93055767	missense	probably damaging	0.98
R5808:Kif1a	UTSW	1	93042698	missense	probably damaging	0.99
R6027:Kif1a	UTSW	1	93025643	missense	probably benign	0.33
R6056:Kif1a	UTSW	1	93024648	missense	probably damaging	1.00
R6077:Kif1a	UTSW	1	93054896	missense	possibly damaging	0.54
R6120:Kif1a	UTSW	1	93024574	splice site	probably null
R6126:Kif1a	UTSW	1	93019899	missense	probably damaging	1.00
R6130:Kif1a	UTSW	1	93036901	missense	probably damaging	1.00
R6255:Kif1a	UTSW	1	93019983	missense	probably damaging	1.00
R6301:Kif1a	UTSW	1	93054941	nonsense	probably null
R6326:Kif1a	UTSW	1	93076326	missense	probably damaging	1.00
R6594:Kif1a	UTSW	1	93021313	missense	probably benign	0.00
R6653:Kif1a	UTSW	1	93077698	missense	probably damaging	1.00
R6791:Kif1a	UTSW	1	93066137	missense	probably damaging	1.00
R6853:Kif1a	UTSW	1	93039802	missense	possibly damaging	0.47
R7022:Kif1a	UTSW	1	93066098	missense	probably benign	0.31
R7059:Kif1a	UTSW	1	93046829	intron	probably benign
R7103:Kif1a	UTSW	1	93077785	missense	probably damaging	1.00
R7248:Kif1a	UTSW	1	93041583	missense	probably benign	0.35
R7259:Kif1a	UTSW	1	93073810	nonsense	probably null
R7659:Kif1a	UTSW	1	93046820	intron	probably benign
R7681:Kif1a	UTSW	1	93054944	missense	probably benign
R7976:Kif1a	UTSW	1	93039774	missense	probably damaging	1.00
R8056:Kif1a	UTSW	1	93054701	intron	probably benign
R8420:Kif1a	UTSW	1	93022419	missense	probably benign
R8994:Kif1a	UTSW	1	93055735	missense	possibly damaging	0.77
R9016:Kif1a	UTSW	1	93025673	missense	probably damaging	1.00
R9206:Kif1a	UTSW	1	93051480	missense	probably damaging	0.99
R9246:Kif1a	UTSW	1	93077779	missense	probably damaging	0.98
R9252:Kif1a	UTSW	1	93075054	missense	probably damaging	1.00
R9388:Kif1a	UTSW	1	93072307	critical splice donor site	probably null
R9413:Kif1a	UTSW	1	93021297	missense	probably benign	0.00
Z1176:Kif1a	UTSW	1	93021316	missense	probably damaging	0.97
Z1176:Kif1a	UTSW	1	93022491	missense	probably damaging	1.00
Z1176:Kif1a	UTSW	1	93055697	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GGAACACTGAGCCACCTTCTAAG -3'
(R):5'- GAACTTTCACGGCATGGATG -3'

Sequencing Primer
(F):5'- GCCAAACTGTTCCTTCAGTACCAG -3'
(R):5'- ACTTTCACGGCATGGATGAATGG -3'

Posted On

2019-10-07