Incidental Mutation 'R7424:Slc19a2'
ID 575889
Institutional Source Beutler Lab
Gene Symbol Slc19a2
Ensembl Gene ENSMUSG00000040918
Gene Name solute carrier family 19 (thiamine transporter), member 2
Synonyms TRMA, DDA1, THTR1
MMRRC Submission 045502-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.148) question?
Stock # R7424 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 164076615-164092954 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 164088445 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 298 (C298S)
Ref Sequence ENSEMBL: ENSMUSP00000037561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044021] [ENSMUST00000159230] [ENSMUST00000169394]
AlphaFold Q9EQN9
Predicted Effect probably benign
Transcript: ENSMUST00000044021
AA Change: C298S

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000037561
Gene: ENSMUSG00000040918
AA Change: C298S

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
Pfam:Folate_carrier 28 459 2.7e-180 PFAM
Pfam:MFS_1 34 441 2.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159230
AA Change: C260S

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000123870
Gene: ENSMUSG00000040918
AA Change: C260S

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
Pfam:Folate_carrier 28 421 1.6e-176 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000169394
AA Change: C97S

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131327
Gene: ENSMUSG00000040918
AA Change: C97S

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
Pfam:Folate_carrier 28 70 3.7e-17 PFAM
Pfam:Folate_carrier 65 258 6.7e-85 PFAM
Meta Mutation Damage Score 0.0599 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the thiamin transporter protein. Mutations in this gene cause thiamin-responsive megaloblastic anemia syndrome (TRMA), which is an autosomal recessive disorder characterized by diabetes mellitus, megaloblastic anemia and sensorineural deafness. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygotes for targeted null alleles exhibit a grossly normal phenotype except for reduced testis size and male infertility. On a low-thiamine diet, mutants show premature death and sensorineural deafness, while homozygotes for one targeted allele also display diabetes mellitus and megaloblastosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik C T 8: 120,872,284 (GRCm39) R71C probably damaging Het
Aanat A T 11: 116,486,455 (GRCm39) probably benign Het
Ahrr G T 13: 74,405,664 (GRCm39) S91* probably null Het
Ampd1 A T 3: 102,995,758 (GRCm39) N223Y probably benign Het
Ankar T G 1: 72,719,217 (GRCm39) N544T probably damaging Het
Ankk1 A G 9: 49,330,050 (GRCm39) S302P possibly damaging Het
Bcr T C 10: 74,992,932 (GRCm39) V809A probably benign Het
Bpifb2 A G 2: 153,732,460 (GRCm39) N353S possibly damaging Het
Cyth1 A T 11: 118,074,835 (GRCm39) probably null Het
Ddx5 A T 11: 106,673,006 (GRCm39) N506K probably benign Het
Dnaja1 A T 4: 40,730,244 (GRCm39) I239F probably benign Het
Ethe1 C T 7: 24,305,676 (GRCm39) T141I probably damaging Het
Fhip2b T C 14: 70,831,447 (GRCm39) H29R probably damaging Het
Gdap2 A T 3: 100,109,382 (GRCm39) I36F unknown Het
Gm13030 A T 4: 138,598,577 (GRCm39) D115E unknown Het
Gm17019 A T 5: 15,079,386 (GRCm39) L227Q probably damaging Het
Gm9195 T A 14: 72,673,217 (GRCm39) E2517D possibly damaging Het
Gramd2a T A 9: 59,615,354 (GRCm39) V39D possibly damaging Het
Hmcn1 C T 1: 150,506,017 (GRCm39) W3836* probably null Het
Hspa14 C T 2: 3,490,078 (GRCm39) D494N possibly damaging Het
Ifit2 A G 19: 34,550,598 (GRCm39) N46S probably benign Het
Ifna6 A T 4: 88,746,044 (GRCm39) E131V possibly damaging Het
Ift140 T C 17: 25,256,010 (GRCm39) V504A possibly damaging Het
Irgc T C 7: 24,131,653 (GRCm39) N388S probably damaging Het
Itgal T A 7: 126,916,537 (GRCm39) V743E probably benign Het
Itih5 T C 2: 10,250,448 (GRCm39) S716P probably damaging Het
Kcnab1 A T 3: 65,173,924 (GRCm39) K78N possibly damaging Het
Kif1a A T 1: 92,982,039 (GRCm39) V787E possibly damaging Het
Krt15 A T 11: 100,026,386 (GRCm39) V100E possibly damaging Het
Krt39 A T 11: 99,408,917 (GRCm39) V293E probably damaging Het
Lrrn4 A G 2: 132,711,663 (GRCm39) F720S possibly damaging Het
Map2 G A 1: 66,453,983 (GRCm39) A958T possibly damaging Het
Map3k9 A G 12: 81,770,871 (GRCm39) S906P probably benign Het
Mdc1 T C 17: 36,164,201 (GRCm39) S1250P probably benign Het
Meltf G A 16: 31,703,764 (GRCm39) V164I probably damaging Het
Mtap T G 4: 89,097,699 (GRCm39) probably null Het
Mtus1 C A 8: 41,475,443 (GRCm39) V184F probably damaging Het
Myh1 A T 11: 67,104,489 (GRCm39) D1015V probably damaging Het
Ndrg1 T C 15: 66,816,787 (GRCm39) probably null Het
Nkd1 G T 8: 89,311,803 (GRCm39) V130L probably benign Het
Nsfl1c A G 2: 151,342,673 (GRCm39) D81G probably benign Het
Nt5c1b T A 12: 10,431,391 (GRCm39) probably null Het
Nucb1 T C 7: 45,148,202 (GRCm39) K204E possibly damaging Het
Nwd1 T G 8: 73,401,801 (GRCm39) M774R possibly damaging Het
Or2m13 A T 16: 19,225,944 (GRCm39) V274E probably damaging Het
Or52u1 G C 7: 104,237,907 (GRCm39) E299Q probably damaging Het
Or5an1c A T 19: 12,218,318 (GRCm39) S236T possibly damaging Het
Pan3 T A 5: 147,473,082 (GRCm39) probably null Het
Pcdh15 A T 10: 74,342,317 (GRCm39) T1135S probably benign Het
Pfas A G 11: 68,890,918 (GRCm39) I331T probably damaging Het
Plxna2 T A 1: 194,488,647 (GRCm39) I1641N probably damaging Het
Pramel27 C T 4: 143,579,779 (GRCm39) P455S probably benign Het
Ptar1 A T 19: 23,695,465 (GRCm39) R311W probably damaging Het
Ranbp2 T G 10: 58,315,016 (GRCm39) M1912R probably damaging Het
Rbm12 A G 2: 155,939,223 (GRCm39) F350L possibly damaging Het
Sdhaf1 T C 7: 30,021,468 (GRCm39) D96G probably benign Het
Serpinb6b T A 13: 33,152,650 (GRCm39) M53K probably damaging Het
Sh2d6 A T 6: 72,494,147 (GRCm39) L147Q probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,457,222 (GRCm39) probably benign Het
St8sia2 T A 7: 73,610,650 (GRCm39) Q211L possibly damaging Het
Sult2a2 T C 7: 13,468,822 (GRCm39) I96T possibly damaging Het
Tab2 G T 10: 7,783,247 (GRCm39) H678Q probably damaging Het
Tnfaip6 A G 2: 51,928,228 (GRCm39) E14G probably benign Het
Trip11 A T 12: 101,851,457 (GRCm39) L869H probably damaging Het
Tslp T C 18: 32,952,133 (GRCm39) Y133H not run Het
Ttn T C 2: 76,571,334 (GRCm39) I26520V probably damaging Het
Ttn A G 2: 76,762,487 (GRCm39) V3374A unknown Het
Tubgcp2 T A 7: 139,587,837 (GRCm39) I263F possibly damaging Het
Uaca A G 9: 60,777,392 (GRCm39) E593G probably damaging Het
Unc13b C T 4: 43,172,235 (GRCm39) T1021I unknown Het
Ush1c T A 7: 45,874,979 (GRCm39) I131F probably benign Het
Usp24 C A 4: 106,236,304 (GRCm39) D997E probably benign Het
Usp54 T C 14: 20,627,108 (GRCm39) T517A probably benign Het
Vmn1r151 A T 7: 22,198,505 (GRCm39) M200K possibly damaging Het
Vmn2r43 T C 7: 8,258,328 (GRCm39) D295G probably damaging Het
Vmn2r70 G A 7: 85,213,076 (GRCm39) P444S probably damaging Het
Vmn2r85 G T 10: 130,254,849 (GRCm39) P612T probably damaging Het
Vps13d A T 4: 144,875,317 (GRCm39) V1736D Het
Zbtb11 A T 16: 55,810,850 (GRCm39) H336L probably benign Het
Other mutations in Slc19a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01464:Slc19a2 APN 1 164,088,430 (GRCm39) missense probably damaging 1.00
IGL03231:Slc19a2 APN 1 164,088,449 (GRCm39) missense probably damaging 1.00
R0324:Slc19a2 UTSW 1 164,084,344 (GRCm39) missense probably damaging 1.00
R0709:Slc19a2 UTSW 1 164,084,367 (GRCm39) missense probably damaging 1.00
R1117:Slc19a2 UTSW 1 164,091,025 (GRCm39) missense possibly damaging 0.86
R1165:Slc19a2 UTSW 1 164,091,014 (GRCm39) missense probably damaging 1.00
R1463:Slc19a2 UTSW 1 164,084,766 (GRCm39) missense probably damaging 0.98
R1833:Slc19a2 UTSW 1 164,089,753 (GRCm39) missense probably damaging 1.00
R2148:Slc19a2 UTSW 1 164,089,657 (GRCm39) missense probably damaging 1.00
R2680:Slc19a2 UTSW 1 164,076,982 (GRCm39) missense probably damaging 1.00
R4010:Slc19a2 UTSW 1 164,088,451 (GRCm39) missense probably damaging 1.00
R5850:Slc19a2 UTSW 1 164,091,025 (GRCm39) missense probably benign 0.00
R6279:Slc19a2 UTSW 1 164,084,344 (GRCm39) missense probably damaging 1.00
R6300:Slc19a2 UTSW 1 164,084,344 (GRCm39) missense probably damaging 1.00
R6907:Slc19a2 UTSW 1 164,090,323 (GRCm39) missense possibly damaging 0.79
R6917:Slc19a2 UTSW 1 164,088,578 (GRCm39) missense probably damaging 1.00
R6982:Slc19a2 UTSW 1 164,084,428 (GRCm39) missense possibly damaging 0.88
R6993:Slc19a2 UTSW 1 164,088,391 (GRCm39) missense probably benign 0.00
R7575:Slc19a2 UTSW 1 164,084,691 (GRCm39) missense probably damaging 1.00
R8193:Slc19a2 UTSW 1 164,084,794 (GRCm39) missense probably benign 0.13
R8831:Slc19a2 UTSW 1 164,084,443 (GRCm39) missense probably damaging 1.00
R9424:Slc19a2 UTSW 1 164,076,895 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCGAGTAAAATAAGCACTTGG -3'
(R):5'- ACAAGCCATTCCTTTGGGC -3'

Sequencing Primer
(F):5'- AAATAAGCACTTGGTTTTTACAAAGG -3'
(R):5'- CTCTTTCAGAGCTCGGGGGAG -3'
Posted On 2019-10-07