Incidental Mutation 'R7424:Itih5'
ID575892
Institutional Source Beutler Lab
Gene Symbol Itih5
Ensembl Gene ENSMUSG00000025780
Gene Nameinter-alpha (globulin) inhibitor H5
Synonyms5430408M01Rik, 4631408O11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R7424 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location10153571-10256529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10245637 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 716 (S716P)
Ref Sequence ENSEMBL: ENSMUSP00000026886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026886]
Predicted Effect probably damaging
Transcript: ENSMUST00000026886
AA Change: S716P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026886
Gene: ENSMUSG00000025780
AA Change: S716P

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
Pfam:VIT 51 159 5.5e-27 PFAM
VWA 293 476 5.84e-24 SMART
Pfam:ITI_HC_C 716 909 1.7e-60 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heavy chain component of one of the inter-alpha-trypsin inhibitor (ITI) family members. ITI proteins are involved in extracellular matrix stabilization and in the prevention of tumor metastasis. They are also structurally related plasma serine protease inhibitors and are composed of a light chain and varying numbers of heavy chains. This family member is thought to function as a tumor suppressor in breast and thyroid cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik C T 8: 120,145,545 R71C probably damaging Het
Aanat A T 11: 116,595,629 probably benign Het
Ahrr G T 13: 74,257,545 S91* probably null Het
Ampd1 A T 3: 103,088,442 N223Y probably benign Het
Ankar T G 1: 72,680,058 N544T probably damaging Het
Ankk1 A G 9: 49,418,750 S302P possibly damaging Het
Bcr T C 10: 75,157,100 V809A probably benign Het
Bpifb2 A G 2: 153,890,540 N353S possibly damaging Het
Ddx5 A T 11: 106,782,180 N506K probably benign Het
Dnaja1 A T 4: 40,730,244 I239F probably benign Het
Ethe1 C T 7: 24,606,251 T141I probably damaging Het
Fam160b2 T C 14: 70,594,007 H29R probably damaging Het
Gdap2 A T 3: 100,202,066 I36F unknown Het
Gm13030 A T 4: 138,871,266 D115E unknown Het
Gm13103 C T 4: 143,853,209 P455S probably benign Het
Gm17019 A T 5: 15,029,372 L227Q probably damaging Het
Gm9195 T A 14: 72,435,777 E2517D possibly damaging Het
Gramd2 T A 9: 59,708,071 V39D possibly damaging Het
Hmcn1 C T 1: 150,630,266 W3836* probably null Het
Hspa14 C T 2: 3,489,041 D494N possibly damaging Het
Ifit2 A G 19: 34,573,198 N46S probably benign Het
Ifna6 A T 4: 88,827,807 E131V possibly damaging Het
Ift140 T C 17: 25,037,036 V504A possibly damaging Het
Irgc1 T C 7: 24,432,228 N388S probably damaging Het
Itgal T A 7: 127,317,365 V743E probably benign Het
Kcnab1 A T 3: 65,266,503 K78N possibly damaging Het
Kif1a A T 1: 93,054,317 V787E possibly damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Krt39 A T 11: 99,518,091 V293E probably damaging Het
Lrrn4 A G 2: 132,869,743 F720S possibly damaging Het
Map2 G A 1: 66,414,824 A958T possibly damaging Het
Map3k9 A G 12: 81,724,097 S906P probably benign Het
Mdc1 T C 17: 35,853,309 S1250P probably benign Het
Meltf G A 16: 31,884,946 V164I probably damaging Het
Mtus1 C A 8: 41,022,406 V184F probably damaging Het
Myh1 A T 11: 67,213,663 D1015V probably damaging Het
Nkd1 G T 8: 88,585,175 V130L probably benign Het
Nsfl1c A G 2: 151,500,753 D81G probably benign Het
Nucb1 T C 7: 45,498,778 K204E possibly damaging Het
Nwd1 T G 8: 72,675,173 M774R possibly damaging Het
Olfr165 A T 16: 19,407,194 V274E probably damaging Het
Olfr262 A T 19: 12,240,954 S236T possibly damaging Het
Olfr654 G C 7: 104,588,700 E299Q probably damaging Het
Pcdh15 A T 10: 74,506,485 T1135S probably benign Het
Pfas A G 11: 69,000,092 I331T probably damaging Het
Plxna2 T A 1: 194,806,339 I1641N probably damaging Het
Ptar1 A T 19: 23,718,101 R311W probably damaging Het
Ranbp2 T G 10: 58,479,194 M1912R probably damaging Het
Rbm12 A G 2: 156,097,303 F350L possibly damaging Het
Sdhaf1 T C 7: 30,322,043 D96G probably benign Het
Serpinb6b T A 13: 32,968,667 M53K probably damaging Het
Sh2d6 A T 6: 72,517,164 L147Q probably benign Het
Slc19a2 T A 1: 164,260,876 C298S probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
St8sia2 T A 7: 73,960,902 Q211L possibly damaging Het
Sult2a2 T C 7: 13,734,897 I96T possibly damaging Het
Tab2 G T 10: 7,907,483 H678Q probably damaging Het
Tnfaip6 A G 2: 52,038,216 E14G probably benign Het
Trip11 A T 12: 101,885,198 L869H probably damaging Het
Tslp T C 18: 32,819,080 Y133H not run Het
Ttn T C 2: 76,740,990 I26520V probably damaging Het
Ttn A G 2: 76,932,143 V3374A unknown Het
Tubgcp2 T A 7: 140,007,924 I263F possibly damaging Het
Uaca A G 9: 60,870,110 E593G probably damaging Het
Unc13b C T 4: 43,172,235 T1021I unknown Het
Ush1c T A 7: 46,225,555 I131F probably benign Het
Usp24 C A 4: 106,379,107 D997E probably benign Het
Usp54 T C 14: 20,577,040 T517A probably benign Het
Vmn1r151 A T 7: 22,499,080 M200K possibly damaging Het
Vmn2r43 T C 7: 8,255,329 D295G probably damaging Het
Vmn2r70 G A 7: 85,563,868 P444S probably damaging Het
Vmn2r85 G T 10: 130,418,980 P612T probably damaging Het
Vps13d A T 4: 145,148,747 V1736D Het
Zbtb11 A T 16: 55,990,487 H336L probably benign Het
Other mutations in Itih5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Itih5 APN 2 10190289 missense probably damaging 1.00
IGL02125:Itih5 APN 2 10240987 missense probably benign
IGL02370:Itih5 APN 2 10186975 missense probably benign 0.05
IGL03376:Itih5 APN 2 10206773 missense probably benign 0.12
IGL02991:Itih5 UTSW 2 10251351 missense probably benign 0.01
R0090:Itih5 UTSW 2 10164684 missense probably benign 0.03
R0096:Itih5 UTSW 2 10251378 missense probably benign 0.02
R0096:Itih5 UTSW 2 10251378 missense probably benign 0.02
R0158:Itih5 UTSW 2 10234992 splice site probably benign
R0270:Itih5 UTSW 2 10251264 missense probably benign 0.38
R0276:Itih5 UTSW 2 10185564 missense possibly damaging 0.80
R0807:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0810:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0903:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0905:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0906:Itih5 UTSW 2 10249188 missense probably benign 0.00
R1104:Itih5 UTSW 2 10251512 missense probably benign 0.03
R1397:Itih5 UTSW 2 10240807 missense probably benign 0.14
R1671:Itih5 UTSW 2 10186971 missense probably benign 0.03
R1971:Itih5 UTSW 2 10238568 missense probably damaging 1.00
R3684:Itih5 UTSW 2 10238624 missense possibly damaging 0.93
R3685:Itih5 UTSW 2 10238624 missense possibly damaging 0.93
R3831:Itih5 UTSW 2 10251270 missense possibly damaging 0.95
R3934:Itih5 UTSW 2 10245544 missense probably damaging 0.98
R4670:Itih5 UTSW 2 10190369 missense probably benign 0.01
R4803:Itih5 UTSW 2 10240581 missense probably benign
R4950:Itih5 UTSW 2 10235081 missense probably damaging 0.98
R5020:Itih5 UTSW 2 10240504 intron probably null
R5735:Itih5 UTSW 2 10240761 missense probably benign 0.00
R6454:Itih5 UTSW 2 10240668 missense probably benign
R6662:Itih5 UTSW 2 10249181 missense probably benign 0.13
R7019:Itih5 UTSW 2 10190327 missense probably damaging 1.00
R7068:Itih5 UTSW 2 10249304 missense probably damaging 0.99
R7246:Itih5 UTSW 2 10187062 splice site probably null
R7452:Itih5 UTSW 2 10238796 missense probably damaging 1.00
R7597:Itih5 UTSW 2 10249376 missense probably damaging 1.00
X0026:Itih5 UTSW 2 10238559 splice site probably null
Predicted Primers PCR Primer
(F):5'- AAGGACACTGTTCTTGCAGC -3'
(R):5'- AGTTCCTTTACCAATCATCGGTG -3'

Sequencing Primer
(F):5'- GTTCTTGCAGCCTTACGATTATG -3'
(R):5'- TGCCCACTGAGCATCTAGACTG -3'
Posted On2019-10-07