Incidental Mutation 'R7424:Lrrn4'
ID575896
Institutional Source Beutler Lab
Gene Symbol Lrrn4
Ensembl Gene ENSMUSG00000043110
Gene Nameleucine rich repeat neuronal 4
SynonymsB430119L13Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R7424 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location132868305-132880891 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 132869743 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 720 (F720S)
Ref Sequence ENSEMBL: ENSMUSP00000057005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028835] [ENSMUST00000049787] [ENSMUST00000124834] [ENSMUST00000124836] [ENSMUST00000154160]
Predicted Effect probably benign
Transcript: ENSMUST00000028835
SMART Domains Protein: ENSMUSP00000028835
Gene: ENSMUSG00000027357

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
low complexity region 71 93 N/A INTRINSIC
Pfam:CDP-OH_P_transf 107 288 1.5e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000049787
AA Change: F720S

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000057005
Gene: ENSMUSG00000043110
AA Change: F720S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LRR 105 126 7.36e0 SMART
LRR_TYP 128 151 3.44e-4 SMART
LRR 153 175 1.19e1 SMART
LRR 176 199 1.53e1 SMART
LRR 205 228 2.03e1 SMART
LRR 229 253 3.36e2 SMART
LRRCT 311 363 6.92e-2 SMART
low complexity region 520 530 N/A INTRINSIC
FN3 577 656 3.73e-10 SMART
transmembrane domain 679 701 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124834
SMART Domains Protein: ENSMUSP00000129509
Gene: ENSMUSG00000027357

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
low complexity region 71 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124836
SMART Domains Protein: ENSMUSP00000132682
Gene: ENSMUSG00000027357

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 1 175 1.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154160
SMART Domains Protein: ENSMUSP00000129137
Gene: ENSMUSG00000027357

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 7 187 1.8e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutant mice exhibit impaired memory retention in hippocampus- dependent learning tasks such as contextual conditioning and spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik C T 8: 120,145,545 R71C probably damaging Het
Aanat A T 11: 116,595,629 probably benign Het
Ahrr G T 13: 74,257,545 S91* probably null Het
Ampd1 A T 3: 103,088,442 N223Y probably benign Het
Ankar T G 1: 72,680,058 N544T probably damaging Het
Ankk1 A G 9: 49,418,750 S302P possibly damaging Het
Bcr T C 10: 75,157,100 V809A probably benign Het
Bpifb2 A G 2: 153,890,540 N353S possibly damaging Het
Ddx5 A T 11: 106,782,180 N506K probably benign Het
Dnaja1 A T 4: 40,730,244 I239F probably benign Het
Ethe1 C T 7: 24,606,251 T141I probably damaging Het
Fam160b2 T C 14: 70,594,007 H29R probably damaging Het
Gdap2 A T 3: 100,202,066 I36F unknown Het
Gm13030 A T 4: 138,871,266 D115E unknown Het
Gm13103 C T 4: 143,853,209 P455S probably benign Het
Gm17019 A T 5: 15,029,372 L227Q probably damaging Het
Gm9195 T A 14: 72,435,777 E2517D possibly damaging Het
Gramd2 T A 9: 59,708,071 V39D possibly damaging Het
Hmcn1 C T 1: 150,630,266 W3836* probably null Het
Hspa14 C T 2: 3,489,041 D494N possibly damaging Het
Ifit2 A G 19: 34,573,198 N46S probably benign Het
Ifna6 A T 4: 88,827,807 E131V possibly damaging Het
Ift140 T C 17: 25,037,036 V504A possibly damaging Het
Irgc1 T C 7: 24,432,228 N388S probably damaging Het
Itgal T A 7: 127,317,365 V743E probably benign Het
Itih5 T C 2: 10,245,637 S716P probably damaging Het
Kcnab1 A T 3: 65,266,503 K78N possibly damaging Het
Kif1a A T 1: 93,054,317 V787E possibly damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Krt39 A T 11: 99,518,091 V293E probably damaging Het
Map2 G A 1: 66,414,824 A958T possibly damaging Het
Map3k9 A G 12: 81,724,097 S906P probably benign Het
Mdc1 T C 17: 35,853,309 S1250P probably benign Het
Meltf G A 16: 31,884,946 V164I probably damaging Het
Mtus1 C A 8: 41,022,406 V184F probably damaging Het
Myh1 A T 11: 67,213,663 D1015V probably damaging Het
Nkd1 G T 8: 88,585,175 V130L probably benign Het
Nsfl1c A G 2: 151,500,753 D81G probably benign Het
Nucb1 T C 7: 45,498,778 K204E possibly damaging Het
Nwd1 T G 8: 72,675,173 M774R possibly damaging Het
Olfr165 A T 16: 19,407,194 V274E probably damaging Het
Olfr262 A T 19: 12,240,954 S236T possibly damaging Het
Olfr654 G C 7: 104,588,700 E299Q probably damaging Het
Pcdh15 A T 10: 74,506,485 T1135S probably benign Het
Pfas A G 11: 69,000,092 I331T probably damaging Het
Plxna2 T A 1: 194,806,339 I1641N probably damaging Het
Ptar1 A T 19: 23,718,101 R311W probably damaging Het
Ranbp2 T G 10: 58,479,194 M1912R probably damaging Het
Rbm12 A G 2: 156,097,303 F350L possibly damaging Het
Sdhaf1 T C 7: 30,322,043 D96G probably benign Het
Serpinb6b T A 13: 32,968,667 M53K probably damaging Het
Sh2d6 A T 6: 72,517,164 L147Q probably benign Het
Slc19a2 T A 1: 164,260,876 C298S probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
St8sia2 T A 7: 73,960,902 Q211L possibly damaging Het
Sult2a2 T C 7: 13,734,897 I96T possibly damaging Het
Tab2 G T 10: 7,907,483 H678Q probably damaging Het
Tnfaip6 A G 2: 52,038,216 E14G probably benign Het
Trip11 A T 12: 101,885,198 L869H probably damaging Het
Tslp T C 18: 32,819,080 Y133H not run Het
Ttn T C 2: 76,740,990 I26520V probably damaging Het
Ttn A G 2: 76,932,143 V3374A unknown Het
Tubgcp2 T A 7: 140,007,924 I263F possibly damaging Het
Uaca A G 9: 60,870,110 E593G probably damaging Het
Unc13b C T 4: 43,172,235 T1021I unknown Het
Ush1c T A 7: 46,225,555 I131F probably benign Het
Usp24 C A 4: 106,379,107 D997E probably benign Het
Usp54 T C 14: 20,577,040 T517A probably benign Het
Vmn1r151 A T 7: 22,499,080 M200K possibly damaging Het
Vmn2r43 T C 7: 8,255,329 D295G probably damaging Het
Vmn2r70 G A 7: 85,563,868 P444S probably damaging Het
Vmn2r85 G T 10: 130,418,980 P612T probably damaging Het
Vps13d A T 4: 145,148,747 V1736D Het
Zbtb11 A T 16: 55,990,487 H336L probably benign Het
Other mutations in Lrrn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Lrrn4 APN 2 132870817 missense probably damaging 1.00
IGL00661:Lrrn4 APN 2 132870668 missense probably benign 0.08
IGL01542:Lrrn4 APN 2 132879472 missense probably benign
IGL01584:Lrrn4 APN 2 132878076 missense probably damaging 1.00
IGL01723:Lrrn4 APN 2 132870061 missense possibly damaging 0.79
R0270:Lrrn4 UTSW 2 132870719 missense probably benign 0.01
R0348:Lrrn4 UTSW 2 132870443 missense probably benign 0.02
R0400:Lrrn4 UTSW 2 132878020 missense probably benign 0.12
R0701:Lrrn4 UTSW 2 132870160 missense probably benign 0.02
R1465:Lrrn4 UTSW 2 132872075 missense probably damaging 1.00
R1465:Lrrn4 UTSW 2 132872075 missense probably damaging 1.00
R1664:Lrrn4 UTSW 2 132869966 missense probably damaging 1.00
R1987:Lrrn4 UTSW 2 132870443 missense probably benign 0.02
R3409:Lrrn4 UTSW 2 132879861 missense unknown
R3743:Lrrn4 UTSW 2 132869866 unclassified probably null
R4678:Lrrn4 UTSW 2 132879568 missense probably benign 0.16
R5770:Lrrn4 UTSW 2 132872156 missense probably damaging 1.00
R6438:Lrrn4 UTSW 2 132870142 missense probably damaging 1.00
R6511:Lrrn4 UTSW 2 132870326 missense probably benign 0.06
R6880:Lrrn4 UTSW 2 132872112 missense probably damaging 0.96
R7132:Lrrn4 UTSW 2 132879693 nonsense probably null
R7273:Lrrn4 UTSW 2 132879829 missense unknown
R7710:Lrrn4 UTSW 2 132879531 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGGCATCAGCATGTTTCTGC -3'
(R):5'- AGGTCATGTGCCACTTTCAC -3'

Sequencing Primer
(F):5'- GATAATTGAAGTTCTGGAGCCTCTGC -3'
(R):5'- TGTGCCACTTTCACAACCAAG -3'
Posted On2019-10-07