Incidental Mutation 'R7424:Kcnab1'
ID 575900
Institutional Source Beutler Lab
Gene Symbol Kcnab1
Ensembl Gene ENSMUSG00000027827
Gene Name potassium voltage-gated channel, shaker-related subfamily, beta member 1
Synonyms mKv(beta)1, Akr8a8, Kvbeta1.1
MMRRC Submission 045502-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R7424 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 64856636-65285643 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 65173924 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 78 (K78N)
Ref Sequence ENSEMBL: ENSMUSP00000047480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049230]
AlphaFold P63143
Predicted Effect possibly damaging
Transcript: ENSMUST00000049230
AA Change: K78N

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000047480
Gene: ENSMUSG00000027827
AA Change: K78N

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 85 390 1.8e-73 PFAM
Meta Mutation Damage Score 0.0745 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member includes distinct isoforms which are encoded by alternatively spliced transcript variants of this gene. Some of these isoforms are beta subunits, which form heteromultimeric complexes with alpha subunits and modulate the activity of the pore-forming alpha subunits. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene experience some learning defects but are otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik C T 8: 120,872,284 (GRCm39) R71C probably damaging Het
Aanat A T 11: 116,486,455 (GRCm39) probably benign Het
Ahrr G T 13: 74,405,664 (GRCm39) S91* probably null Het
Ampd1 A T 3: 102,995,758 (GRCm39) N223Y probably benign Het
Ankar T G 1: 72,719,217 (GRCm39) N544T probably damaging Het
Ankk1 A G 9: 49,330,050 (GRCm39) S302P possibly damaging Het
Bcr T C 10: 74,992,932 (GRCm39) V809A probably benign Het
Bpifb2 A G 2: 153,732,460 (GRCm39) N353S possibly damaging Het
Cyth1 A T 11: 118,074,835 (GRCm39) probably null Het
Ddx5 A T 11: 106,673,006 (GRCm39) N506K probably benign Het
Dnaja1 A T 4: 40,730,244 (GRCm39) I239F probably benign Het
Ethe1 C T 7: 24,305,676 (GRCm39) T141I probably damaging Het
Fhip2b T C 14: 70,831,447 (GRCm39) H29R probably damaging Het
Gdap2 A T 3: 100,109,382 (GRCm39) I36F unknown Het
Gm13030 A T 4: 138,598,577 (GRCm39) D115E unknown Het
Gm17019 A T 5: 15,079,386 (GRCm39) L227Q probably damaging Het
Gm9195 T A 14: 72,673,217 (GRCm39) E2517D possibly damaging Het
Gramd2a T A 9: 59,615,354 (GRCm39) V39D possibly damaging Het
Hmcn1 C T 1: 150,506,017 (GRCm39) W3836* probably null Het
Hspa14 C T 2: 3,490,078 (GRCm39) D494N possibly damaging Het
Ifit2 A G 19: 34,550,598 (GRCm39) N46S probably benign Het
Ifna6 A T 4: 88,746,044 (GRCm39) E131V possibly damaging Het
Ift140 T C 17: 25,256,010 (GRCm39) V504A possibly damaging Het
Irgc T C 7: 24,131,653 (GRCm39) N388S probably damaging Het
Itgal T A 7: 126,916,537 (GRCm39) V743E probably benign Het
Itih5 T C 2: 10,250,448 (GRCm39) S716P probably damaging Het
Kif1a A T 1: 92,982,039 (GRCm39) V787E possibly damaging Het
Krt15 A T 11: 100,026,386 (GRCm39) V100E possibly damaging Het
Krt39 A T 11: 99,408,917 (GRCm39) V293E probably damaging Het
Lrrn4 A G 2: 132,711,663 (GRCm39) F720S possibly damaging Het
Map2 G A 1: 66,453,983 (GRCm39) A958T possibly damaging Het
Map3k9 A G 12: 81,770,871 (GRCm39) S906P probably benign Het
Mdc1 T C 17: 36,164,201 (GRCm39) S1250P probably benign Het
Meltf G A 16: 31,703,764 (GRCm39) V164I probably damaging Het
Mtap T G 4: 89,097,699 (GRCm39) probably null Het
Mtus1 C A 8: 41,475,443 (GRCm39) V184F probably damaging Het
Myh1 A T 11: 67,104,489 (GRCm39) D1015V probably damaging Het
Ndrg1 T C 15: 66,816,787 (GRCm39) probably null Het
Nkd1 G T 8: 89,311,803 (GRCm39) V130L probably benign Het
Nsfl1c A G 2: 151,342,673 (GRCm39) D81G probably benign Het
Nt5c1b T A 12: 10,431,391 (GRCm39) probably null Het
Nucb1 T C 7: 45,148,202 (GRCm39) K204E possibly damaging Het
Nwd1 T G 8: 73,401,801 (GRCm39) M774R possibly damaging Het
Or2m13 A T 16: 19,225,944 (GRCm39) V274E probably damaging Het
Or52u1 G C 7: 104,237,907 (GRCm39) E299Q probably damaging Het
Or5an1c A T 19: 12,218,318 (GRCm39) S236T possibly damaging Het
Pan3 T A 5: 147,473,082 (GRCm39) probably null Het
Pcdh15 A T 10: 74,342,317 (GRCm39) T1135S probably benign Het
Pfas A G 11: 68,890,918 (GRCm39) I331T probably damaging Het
Plxna2 T A 1: 194,488,647 (GRCm39) I1641N probably damaging Het
Pramel27 C T 4: 143,579,779 (GRCm39) P455S probably benign Het
Ptar1 A T 19: 23,695,465 (GRCm39) R311W probably damaging Het
Ranbp2 T G 10: 58,315,016 (GRCm39) M1912R probably damaging Het
Rbm12 A G 2: 155,939,223 (GRCm39) F350L possibly damaging Het
Sdhaf1 T C 7: 30,021,468 (GRCm39) D96G probably benign Het
Serpinb6b T A 13: 33,152,650 (GRCm39) M53K probably damaging Het
Sh2d6 A T 6: 72,494,147 (GRCm39) L147Q probably benign Het
Slc19a2 T A 1: 164,088,445 (GRCm39) C298S probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,457,222 (GRCm39) probably benign Het
St8sia2 T A 7: 73,610,650 (GRCm39) Q211L possibly damaging Het
Sult2a2 T C 7: 13,468,822 (GRCm39) I96T possibly damaging Het
Tab2 G T 10: 7,783,247 (GRCm39) H678Q probably damaging Het
Tnfaip6 A G 2: 51,928,228 (GRCm39) E14G probably benign Het
Trip11 A T 12: 101,851,457 (GRCm39) L869H probably damaging Het
Tslp T C 18: 32,952,133 (GRCm39) Y133H not run Het
Ttn T C 2: 76,571,334 (GRCm39) I26520V probably damaging Het
Ttn A G 2: 76,762,487 (GRCm39) V3374A unknown Het
Tubgcp2 T A 7: 139,587,837 (GRCm39) I263F possibly damaging Het
Uaca A G 9: 60,777,392 (GRCm39) E593G probably damaging Het
Unc13b C T 4: 43,172,235 (GRCm39) T1021I unknown Het
Ush1c T A 7: 45,874,979 (GRCm39) I131F probably benign Het
Usp24 C A 4: 106,236,304 (GRCm39) D997E probably benign Het
Usp54 T C 14: 20,627,108 (GRCm39) T517A probably benign Het
Vmn1r151 A T 7: 22,198,505 (GRCm39) M200K possibly damaging Het
Vmn2r43 T C 7: 8,258,328 (GRCm39) D295G probably damaging Het
Vmn2r70 G A 7: 85,213,076 (GRCm39) P444S probably damaging Het
Vmn2r85 G T 10: 130,254,849 (GRCm39) P612T probably damaging Het
Vps13d A T 4: 144,875,317 (GRCm39) V1736D Het
Zbtb11 A T 16: 55,810,850 (GRCm39) H336L probably benign Het
Other mutations in Kcnab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01819:Kcnab1 APN 3 65,226,875 (GRCm39) missense probably damaging 1.00
IGL01936:Kcnab1 APN 3 65,265,695 (GRCm39) missense probably damaging 1.00
IGL02291:Kcnab1 APN 3 65,264,503 (GRCm39) missense possibly damaging 0.94
IGL02425:Kcnab1 APN 3 65,209,600 (GRCm39) missense possibly damaging 0.59
PIT4418001:Kcnab1 UTSW 3 65,265,741 (GRCm39) missense probably benign 0.12
R0017:Kcnab1 UTSW 3 65,264,527 (GRCm39) missense probably damaging 0.98
R0017:Kcnab1 UTSW 3 65,264,527 (GRCm39) missense probably damaging 0.98
R0811:Kcnab1 UTSW 3 65,205,141 (GRCm39) missense probably damaging 1.00
R0812:Kcnab1 UTSW 3 65,205,141 (GRCm39) missense probably damaging 1.00
R1847:Kcnab1 UTSW 3 65,209,615 (GRCm39) critical splice donor site probably null
R1926:Kcnab1 UTSW 3 65,283,933 (GRCm39) missense possibly damaging 0.73
R2064:Kcnab1 UTSW 3 65,272,060 (GRCm39) missense probably benign 0.07
R2152:Kcnab1 UTSW 3 65,278,861 (GRCm39) missense probably damaging 0.99
R2153:Kcnab1 UTSW 3 65,278,861 (GRCm39) missense probably damaging 0.99
R2197:Kcnab1 UTSW 3 65,017,368 (GRCm39) missense probably benign 0.00
R2233:Kcnab1 UTSW 3 65,226,888 (GRCm39) missense probably damaging 1.00
R2235:Kcnab1 UTSW 3 65,226,888 (GRCm39) missense probably damaging 1.00
R2437:Kcnab1 UTSW 3 65,264,435 (GRCm39) splice site probably benign
R3916:Kcnab1 UTSW 3 65,211,585 (GRCm39) critical splice donor site probably null
R4093:Kcnab1 UTSW 3 65,207,035 (GRCm39) missense possibly damaging 0.96
R4347:Kcnab1 UTSW 3 65,204,896 (GRCm39) intron probably benign
R4796:Kcnab1 UTSW 3 65,211,586 (GRCm39) critical splice donor site probably null
R5588:Kcnab1 UTSW 3 65,283,976 (GRCm39) missense possibly damaging 0.59
R7254:Kcnab1 UTSW 3 65,226,908 (GRCm39) missense probably benign 0.08
R7347:Kcnab1 UTSW 3 65,283,952 (GRCm39) missense probably benign 0.07
Z1177:Kcnab1 UTSW 3 65,264,554 (GRCm39) missense probably benign 0.08
Z1177:Kcnab1 UTSW 3 65,173,931 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTAAGCCTGAGATTTTGAGTTTC -3'
(R):5'- TTGATGAGCATGCTGGACAAG -3'

Sequencing Primer
(F):5'- CCTCAGCTCTTGTCAAGAA -3'
(R):5'- GGAAAGCCTTCCTCAGGGG -3'
Posted On 2019-10-07