Incidental Mutation 'R7424:Ampd1'
ID575902
Institutional Source Beutler Lab
Gene Symbol Ampd1
Ensembl Gene ENSMUSG00000070385
Gene Nameadenosine monophosphate deaminase 1
SynonymsAmpd-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #R7424 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location103074014-103099720 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103088442 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 223 (N223Y)
Ref Sequence ENSEMBL: ENSMUSP00000088217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090715] [ENSMUST00000155034] [ENSMUST00000176440]
Predicted Effect probably benign
Transcript: ENSMUST00000090715
AA Change: N223Y

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000088217
Gene: ENSMUSG00000070385
AA Change: N223Y

DomainStartEndE-ValueType
low complexity region 234 246 N/A INTRINSIC
Pfam:A_deaminase 294 701 5.4e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155034
AA Change: N223Y

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143129
Gene: ENSMUSG00000070385
AA Change: N223Y

DomainStartEndE-ValueType
low complexity region 234 246 N/A INTRINSIC
Pfam:A_deaminase 294 676 5.2e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176440
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adenosine monophosphate deaminase 1 catalyzes the deamination of AMP to IMP in skeletal muscle and plays an important role in the purine nucleotide cycle. Two other genes have been identified, AMPD2 and AMPD3, for the liver- and erythocyte-specific isoforms, respectively. Deficiency of the muscle-specific enzyme is apparently a common cause of exercise-induced myopathy and probably the most common cause of metabolic myopathy in the human. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik C T 8: 120,145,545 R71C probably damaging Het
Aanat A T 11: 116,595,629 probably benign Het
Ahrr G T 13: 74,257,545 S91* probably null Het
Ankar T G 1: 72,680,058 N544T probably damaging Het
Ankk1 A G 9: 49,418,750 S302P possibly damaging Het
Bcr T C 10: 75,157,100 V809A probably benign Het
Bpifb2 A G 2: 153,890,540 N353S possibly damaging Het
Cyth1 A T 11: 118,184,009 probably null Het
Ddx5 A T 11: 106,782,180 N506K probably benign Het
Dnaja1 A T 4: 40,730,244 I239F probably benign Het
Ethe1 C T 7: 24,606,251 T141I probably damaging Het
Fam160b2 T C 14: 70,594,007 H29R probably damaging Het
Gdap2 A T 3: 100,202,066 I36F unknown Het
Gm13030 A T 4: 138,871,266 D115E unknown Het
Gm13103 C T 4: 143,853,209 P455S probably benign Het
Gm17019 A T 5: 15,029,372 L227Q probably damaging Het
Gm9195 T A 14: 72,435,777 E2517D possibly damaging Het
Gramd2 T A 9: 59,708,071 V39D possibly damaging Het
Hmcn1 C T 1: 150,630,266 W3836* probably null Het
Hspa14 C T 2: 3,489,041 D494N possibly damaging Het
Ifit2 A G 19: 34,573,198 N46S probably benign Het
Ifna6 A T 4: 88,827,807 E131V possibly damaging Het
Ift140 T C 17: 25,037,036 V504A possibly damaging Het
Irgc1 T C 7: 24,432,228 N388S probably damaging Het
Itgal T A 7: 127,317,365 V743E probably benign Het
Itih5 T C 2: 10,245,637 S716P probably damaging Het
Kcnab1 A T 3: 65,266,503 K78N possibly damaging Het
Kif1a A T 1: 93,054,317 V787E possibly damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Krt39 A T 11: 99,518,091 V293E probably damaging Het
Lrrn4 A G 2: 132,869,743 F720S possibly damaging Het
Map2 G A 1: 66,414,824 A958T possibly damaging Het
Map3k9 A G 12: 81,724,097 S906P probably benign Het
Mdc1 T C 17: 35,853,309 S1250P probably benign Het
Meltf G A 16: 31,884,946 V164I probably damaging Het
Mtap T G 4: 89,179,462 probably null Het
Mtus1 C A 8: 41,022,406 V184F probably damaging Het
Myh1 A T 11: 67,213,663 D1015V probably damaging Het
Ndrg1 T C 15: 66,944,938 probably null Het
Nkd1 G T 8: 88,585,175 V130L probably benign Het
Nsfl1c A G 2: 151,500,753 D81G probably benign Het
Nt5c1b T A 12: 10,381,391 probably null Het
Nucb1 T C 7: 45,498,778 K204E possibly damaging Het
Nwd1 T G 8: 72,675,173 M774R possibly damaging Het
Olfr165 A T 16: 19,407,194 V274E probably damaging Het
Olfr262 A T 19: 12,240,954 S236T possibly damaging Het
Olfr654 G C 7: 104,588,700 E299Q probably damaging Het
Pan3 T A 5: 147,536,272 probably null Het
Pcdh15 A T 10: 74,506,485 T1135S probably benign Het
Pfas A G 11: 69,000,092 I331T probably damaging Het
Plxna2 T A 1: 194,806,339 I1641N probably damaging Het
Ptar1 A T 19: 23,718,101 R311W probably damaging Het
Ranbp2 T G 10: 58,479,194 M1912R probably damaging Het
Rbm12 A G 2: 156,097,303 F350L possibly damaging Het
Sdhaf1 T C 7: 30,322,043 D96G probably benign Het
Serpinb6b T A 13: 32,968,667 M53K probably damaging Het
Sh2d6 A T 6: 72,517,164 L147Q probably benign Het
Slc19a2 T A 1: 164,260,876 C298S probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
St8sia2 T A 7: 73,960,902 Q211L possibly damaging Het
Sult2a2 T C 7: 13,734,897 I96T possibly damaging Het
Tab2 G T 10: 7,907,483 H678Q probably damaging Het
Tnfaip6 A G 2: 52,038,216 E14G probably benign Het
Trip11 A T 12: 101,885,198 L869H probably damaging Het
Tslp T C 18: 32,819,080 Y133H not run Het
Ttn T C 2: 76,740,990 I26520V probably damaging Het
Ttn A G 2: 76,932,143 V3374A unknown Het
Tubgcp2 T A 7: 140,007,924 I263F possibly damaging Het
Uaca A G 9: 60,870,110 E593G probably damaging Het
Unc13b C T 4: 43,172,235 T1021I unknown Het
Ush1c T A 7: 46,225,555 I131F probably benign Het
Usp24 C A 4: 106,379,107 D997E probably benign Het
Usp54 T C 14: 20,577,040 T517A probably benign Het
Vmn1r151 A T 7: 22,499,080 M200K possibly damaging Het
Vmn2r43 T C 7: 8,255,329 D295G probably damaging Het
Vmn2r70 G A 7: 85,563,868 P444S probably damaging Het
Vmn2r85 G T 10: 130,418,980 P612T probably damaging Het
Vps13d A T 4: 145,148,747 V1736D Het
Zbtb11 A T 16: 55,990,487 H336L probably benign Het
Other mutations in Ampd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Ampd1 APN 3 103099694 missense possibly damaging 0.64
IGL00909:Ampd1 APN 3 103088428 missense probably benign 0.10
IGL01543:Ampd1 APN 3 103095713 missense probably benign 0.00
IGL01743:Ampd1 APN 3 103094885 splice site probably benign
IGL02390:Ampd1 APN 3 103079041 missense probably benign 0.28
IGL02637:Ampd1 APN 3 103094883 splice site probably benign
IGL02735:Ampd1 APN 3 103085377 missense probably damaging 1.00
IGL03151:Ampd1 APN 3 103092470 splice site probably null
twinkle_toes UTSW 3 103095646 nonsense probably null
R0158:Ampd1 UTSW 3 103091730 nonsense probably null
R0441:Ampd1 UTSW 3 103088478 missense probably benign 0.05
R0646:Ampd1 UTSW 3 103099597 missense probably damaging 1.00
R1474:Ampd1 UTSW 3 103098838 missense probably damaging 1.00
R1499:Ampd1 UTSW 3 103091664 missense probably damaging 1.00
R1789:Ampd1 UTSW 3 103099126 missense possibly damaging 0.46
R2131:Ampd1 UTSW 3 103094878 critical splice donor site probably null
R3706:Ampd1 UTSW 3 103088311 splice site probably benign
R4007:Ampd1 UTSW 3 103092460 missense probably damaging 0.99
R4169:Ampd1 UTSW 3 103094841 missense probably damaging 1.00
R4525:Ampd1 UTSW 3 103094733 missense probably damaging 1.00
R4828:Ampd1 UTSW 3 103081097 missense probably damaging 1.00
R5015:Ampd1 UTSW 3 103099665 missense possibly damaging 0.89
R5514:Ampd1 UTSW 3 103079172 missense possibly damaging 0.50
R5839:Ampd1 UTSW 3 103085428 missense possibly damaging 0.47
R5872:Ampd1 UTSW 3 103079130 missense probably benign 0.00
R5890:Ampd1 UTSW 3 103090075 missense probably damaging 1.00
R5986:Ampd1 UTSW 3 103085397 missense probably damaging 1.00
R6272:Ampd1 UTSW 3 103085383 missense possibly damaging 0.50
R6473:Ampd1 UTSW 3 103095646 nonsense probably null
R6504:Ampd1 UTSW 3 103099595 missense possibly damaging 0.90
R7051:Ampd1 UTSW 3 103090073 missense probably damaging 1.00
R7323:Ampd1 UTSW 3 103085380 missense probably benign
R7436:Ampd1 UTSW 3 103074119 critical splice donor site probably null
R7546:Ampd1 UTSW 3 103095712 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACATGGTCATTCCTCCTATGTG -3'
(R):5'- TGCATAAGGCCCTTGCAAG -3'

Sequencing Primer
(F):5'- CCTATGTGCTGATCTATTACTCTGTG -3'
(R):5'- GGCAGTATTTGACAATGATAAGCATG -3'
Posted On2019-10-07