Mutagenetix > Incidental Mutations

Incidental Mutation 'R7424:Usp24'

575906

Institutional Source

Beutler Lab

Gene Symbol

Usp24

Ensembl Gene

ENSMUSG00000028514

Gene Name

ubiquitin specific peptidase 24

Synonyms

2810030C21Rik, 2700066K03Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7424 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

106316213-106441322 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 106379107 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 997 (D997E)

Ref Sequence

ENSEMBL: ENSMUSP00000133095 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094933] [ENSMUST00000165709]

AlphaFold

B1AY13

Predicted Effect

probably benign
Transcript: ENSMUST00000094933
AA Change: D996E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000092538
Gene: ENSMUSG00000028514
AA Change: D996E

Domain	Start	End	E-Value	Type
Blast:UBA	5	43	2e-16	BLAST
low complexity region	57	96	N/A	INTRINSIC
SCOP:d1gw5a_	348	882	6e-7	SMART
low complexity region	1031	1059	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1365	1378	N/A	INTRINSIC
Pfam:UCH	1685	2036	3.7e-54	PFAM
Pfam:UCH_1	1686	1993	1.8e-27	PFAM
low complexity region	2066	2081	N/A	INTRINSIC
low complexity region	2256	2267	N/A	INTRINSIC
low complexity region	2576	2592	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165709
AA Change: D997E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000133095
Gene: ENSMUSG00000028514
AA Change: D997E

Domain	Start	End	E-Value	Type
Blast:UBA	5	43	2e-16	BLAST
low complexity region	57	96	N/A	INTRINSIC
SCOP:d1gw5a_	348	883	8e-7	SMART
low complexity region	1032	1060	N/A	INTRINSIC
low complexity region	1125	1151	N/A	INTRINSIC
low complexity region	1366	1379	N/A	INTRINSIC
Pfam:UCH	1686	2037	2e-49	PFAM
Pfam:UCH_1	1687	1994	4e-24	PFAM
low complexity region	2067	2082	N/A	INTRINSIC
low complexity region	2257	2268	N/A	INTRINSIC
low complexity region	2577	2593	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

99% (76/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP24 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430548M08Rik	C	T	8: 120,145,545	R71C	probably damaging	Het
Aanat	A	T	11: 116,595,629		probably benign	Het
Ahrr	G	T	13: 74,257,545	S91*	probably null	Het
Ampd1	A	T	3: 103,088,442	N223Y	probably benign	Het
Ankar	T	G	1: 72,680,058	N544T	probably damaging	Het
Ankk1	A	G	9: 49,418,750	S302P	possibly damaging	Het
Bcr	T	C	10: 75,157,100	V809A	probably benign	Het
Bpifb2	A	G	2: 153,890,540	N353S	possibly damaging	Het
Cyth1	A	T	11: 118,184,009		probably null	Het
Ddx5	A	T	11: 106,782,180	N506K	probably benign	Het
Dnaja1	A	T	4: 40,730,244	I239F	probably benign	Het
Ethe1	C	T	7: 24,606,251	T141I	probably damaging	Het
Fam160b2	T	C	14: 70,594,007	H29R	probably damaging	Het
Gdap2	A	T	3: 100,202,066	I36F	unknown	Het
Gm13030	A	T	4: 138,871,266	D115E	unknown	Het
Gm13103	C	T	4: 143,853,209	P455S	probably benign	Het
Gm17019	A	T	5: 15,029,372	L227Q	probably damaging	Het
Gm9195	T	A	14: 72,435,777	E2517D	possibly damaging	Het
Gramd2	T	A	9: 59,708,071	V39D	possibly damaging	Het
Hmcn1	C	T	1: 150,630,266	W3836*	probably null	Het
Hspa14	C	T	2: 3,489,041	D494N	possibly damaging	Het
Ifit2	A	G	19: 34,573,198	N46S	probably benign	Het
Ifna6	A	T	4: 88,827,807	E131V	possibly damaging	Het
Ift140	T	C	17: 25,037,036	V504A	possibly damaging	Het
Irgc1	T	C	7: 24,432,228	N388S	probably damaging	Het
Itgal	T	A	7: 127,317,365	V743E	probably benign	Het
Itih5	T	C	2: 10,245,637	S716P	probably damaging	Het
Kcnab1	A	T	3: 65,266,503	K78N	possibly damaging	Het
Kif1a	A	T	1: 93,054,317	V787E	possibly damaging	Het
Krt15	A	T	11: 100,135,560	V100E	possibly damaging	Het
Krt39	A	T	11: 99,518,091	V293E	probably damaging	Het
Lrrn4	A	G	2: 132,869,743	F720S	possibly damaging	Het
Map2	G	A	1: 66,414,824	A958T	possibly damaging	Het
Map3k9	A	G	12: 81,724,097	S906P	probably benign	Het
Mdc1	T	C	17: 35,853,309	S1250P	probably benign	Het
Meltf	G	A	16: 31,884,946	V164I	probably damaging	Het
Mtap	T	G	4: 89,179,462		probably null	Het
Mtus1	C	A	8: 41,022,406	V184F	probably damaging	Het
Myh1	A	T	11: 67,213,663	D1015V	probably damaging	Het
Ndrg1	T	C	15: 66,944,938		probably null	Het
Nkd1	G	T	8: 88,585,175	V130L	probably benign	Het
Nsfl1c	A	G	2: 151,500,753	D81G	probably benign	Het
Nt5c1b	T	A	12: 10,381,391		probably null	Het
Nucb1	T	C	7: 45,498,778	K204E	possibly damaging	Het
Nwd1	T	G	8: 72,675,173	M774R	possibly damaging	Het
Olfr165	A	T	16: 19,407,194	V274E	probably damaging	Het
Olfr262	A	T	19: 12,240,954	S236T	possibly damaging	Het
Olfr654	G	C	7: 104,588,700	E299Q	probably damaging	Het
Pan3	T	A	5: 147,536,272		probably null	Het
Pcdh15	A	T	10: 74,506,485	T1135S	probably benign	Het
Pfas	A	G	11: 69,000,092	I331T	probably damaging	Het
Plxna2	T	A	1: 194,806,339	I1641N	probably damaging	Het
Ptar1	A	T	19: 23,718,101	R311W	probably damaging	Het
Ranbp2	T	G	10: 58,479,194	M1912R	probably damaging	Het
Rbm12	A	G	2: 156,097,303	F350L	possibly damaging	Het
Sdhaf1	T	C	7: 30,322,043	D96G	probably benign	Het
Serpinb6b	T	A	13: 32,968,667	M53K	probably damaging	Het
Sh2d6	A	T	6: 72,517,164	L147Q	probably benign	Het
Slc19a2	T	A	1: 164,260,876	C298S	probably benign	Het
Son	AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG	AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG	16: 91,660,334		probably benign	Het
St8sia2	T	A	7: 73,960,902	Q211L	possibly damaging	Het
Sult2a2	T	C	7: 13,734,897	I96T	possibly damaging	Het
Tab2	G	T	10: 7,907,483	H678Q	probably damaging	Het
Tnfaip6	A	G	2: 52,038,216	E14G	probably benign	Het
Trip11	A	T	12: 101,885,198	L869H	probably damaging	Het
Tslp	T	C	18: 32,819,080	Y133H	not run	Het
Ttn	T	C	2: 76,740,990	I26520V	probably damaging	Het
Ttn	A	G	2: 76,932,143	V3374A	unknown	Het
Tubgcp2	T	A	7: 140,007,924	I263F	possibly damaging	Het
Uaca	A	G	9: 60,870,110	E593G	probably damaging	Het
Unc13b	C	T	4: 43,172,235	T1021I	unknown	Het
Ush1c	T	A	7: 46,225,555	I131F	probably benign	Het
Usp54	T	C	14: 20,577,040	T517A	probably benign	Het
Vmn1r151	A	T	7: 22,499,080	M200K	possibly damaging	Het
Vmn2r43	T	C	7: 8,255,329	D295G	probably damaging	Het
Vmn2r70	G	A	7: 85,563,868	P444S	probably damaging	Het
Vmn2r85	G	T	10: 130,418,980	P612T	probably damaging	Het
Vps13d	A	T	4: 145,148,747	V1736D		Het
Zbtb11	A	T	16: 55,990,487	H336L	probably benign	Het

Other mutations in Usp24

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00329:Usp24	APN	4	106359091	missense	probably benign
IGL00340:Usp24	APN	4	106401139	missense	probably damaging	0.99
IGL00480:Usp24	APN	4	106368106	missense	probably damaging	0.99
IGL00548:Usp24	APN	4	106341298	missense	probably damaging	0.96
IGL00655:Usp24	APN	4	106390318	missense	probably damaging	0.99
IGL00674:Usp24	APN	4	106372679	splice site	probably benign
IGL00718:Usp24	APN	4	106409704	missense	probably benign	0.10
IGL00803:Usp24	APN	4	106385526	splice site	probably benign
IGL01161:Usp24	APN	4	106436844	missense	probably benign	0.02
IGL01344:Usp24	APN	4	106379385	missense	possibly damaging	0.73
IGL01374:Usp24	APN	4	106380099	missense	possibly damaging	0.86
IGL01485:Usp24	APN	4	106362232	missense	probably benign	0.01
IGL01736:Usp24	APN	4	106423461	missense	probably benign	0.00
IGL01737:Usp24	APN	4	106387734	missense	probably benign	0.03
IGL01862:Usp24	APN	4	106408898	splice site	probably benign
IGL01981:Usp24	APN	4	106375768	splice site	probably benign
IGL02090:Usp24	APN	4	106411426	missense	possibly damaging	0.55
IGL02275:Usp24	APN	4	106387493	missense	probably damaging	1.00
IGL02352:Usp24	APN	4	106403925	missense	probably damaging	1.00
IGL02359:Usp24	APN	4	106403925	missense	probably damaging	1.00
IGL02391:Usp24	APN	4	106407129	missense	possibly damaging	0.60
IGL02418:Usp24	APN	4	106436360	missense	probably benign	0.07
IGL02537:Usp24	APN	4	106392367	missense	probably damaging	1.00
IGL02638:Usp24	APN	4	106438770	splice site	probably benign
IGL02638:Usp24	APN	4	106438772	splice site	probably benign
IGL02830:Usp24	APN	4	106347387	missense	possibly damaging	0.79
IGL03125:Usp24	APN	4	106392402	missense	probably benign	0.09
IGL03280:Usp24	APN	4	106380430	missense	probably damaging	1.00
IGL03350:Usp24	APN	4	106371079	nonsense	probably null
BB010:Usp24	UTSW	4	106428489	missense	probably benign
BB020:Usp24	UTSW	4	106428489	missense	probably benign
IGL03098:Usp24	UTSW	4	106371033	missense	probably benign	0.11
R0035:Usp24	UTSW	4	106368027	missense	probably benign	0.18
R0044:Usp24	UTSW	4	106412084	splice site	probably benign
R0086:Usp24	UTSW	4	106392360	missense	probably damaging	0.98
R0125:Usp24	UTSW	4	106397299	missense	possibly damaging	0.76
R0197:Usp24	UTSW	4	106407133	missense	probably damaging	1.00
R0240:Usp24	UTSW	4	106414404	nonsense	probably null
R0240:Usp24	UTSW	4	106414404	nonsense	probably null
R0491:Usp24	UTSW	4	106402105	missense	probably benign	0.41
R0687:Usp24	UTSW	4	106420504	missense	probably damaging	1.00
R0973:Usp24	UTSW	4	106371079	nonsense	probably null
R0973:Usp24	UTSW	4	106413678	splice site	probably null
R0973:Usp24	UTSW	4	106371079	nonsense	probably null
R0974:Usp24	UTSW	4	106371079	nonsense	probably null
R0974:Usp24	UTSW	4	106413678	splice site	probably null
R1163:Usp24	UTSW	4	106420960	missense	probably benign
R1293:Usp24	UTSW	4	106423553	missense	probably benign	0.19
R1333:Usp24	UTSW	4	106342353	missense	possibly damaging	0.55
R1476:Usp24	UTSW	4	106361933	missense	probably damaging	1.00
R1699:Usp24	UTSW	4	106438827	missense	probably damaging	0.99
R1728:Usp24	UTSW	4	106360421	missense	possibly damaging	0.85
R1729:Usp24	UTSW	4	106360421	missense	possibly damaging	0.85
R1753:Usp24	UTSW	4	106377559	missense	probably benign	0.04
R1917:Usp24	UTSW	4	106410286	missense	probably damaging	1.00
R2045:Usp24	UTSW	4	106400980	missense	possibly damaging	0.54
R2424:Usp24	UTSW	4	106399113	critical splice donor site	probably null
R2436:Usp24	UTSW	4	106409645	nonsense	probably null
R2513:Usp24	UTSW	4	106379405	splice site	probably null
R3824:Usp24	UTSW	4	106379066	missense	probably benign
R3831:Usp24	UTSW	4	106362012	critical splice donor site	probably null
R3833:Usp24	UTSW	4	106362012	critical splice donor site	probably null
R3982:Usp24	UTSW	4	106387883	missense	probably benign	0.38
R4022:Usp24	UTSW	4	106379224	splice site	probably benign
R4067:Usp24	UTSW	4	106359089	missense	possibly damaging	0.68
R4175:Usp24	UTSW	4	106316773	missense	probably benign	0.00
R4766:Usp24	UTSW	4	106416048	missense	probably damaging	1.00
R4771:Usp24	UTSW	4	106362180	splice site	probably null
R4798:Usp24	UTSW	4	106360162	missense	possibly damaging	0.82
R4809:Usp24	UTSW	4	106413676	critical splice donor site	probably null
R4822:Usp24	UTSW	4	106416047	missense	probably damaging	0.98
R4906:Usp24	UTSW	4	106388637	missense	probably benign	0.20
R4934:Usp24	UTSW	4	106426546	missense	probably benign	0.29
R5074:Usp24	UTSW	4	106420447	missense	probably benign	0.12
R5151:Usp24	UTSW	4	106399112	critical splice donor site	probably null
R5220:Usp24	UTSW	4	106382303	missense	possibly damaging	0.69
R5279:Usp24	UTSW	4	106385424	missense	possibly damaging	0.94
R5280:Usp24	UTSW	4	106341214	missense	probably benign	0.18
R5285:Usp24	UTSW	4	106407033	missense	probably benign	0.00
R5292:Usp24	UTSW	4	106418263	missense	probably benign	0.06
R5294:Usp24	UTSW	4	106362357	missense	possibly damaging	0.53
R5394:Usp24	UTSW	4	106408013	missense	probably damaging	1.00
R5517:Usp24	UTSW	4	106375674	missense	probably benign	0.02
R5522:Usp24	UTSW	4	106372721	missense	probably damaging	1.00
R5546:Usp24	UTSW	4	106416047	missense	probably damaging	0.98
R5756:Usp24	UTSW	4	106362483	missense	probably damaging	1.00
R5910:Usp24	UTSW	4	106380468	missense	probably damaging	0.99
R5972:Usp24	UTSW	4	106368067	missense	probably damaging	0.98
R6285:Usp24	UTSW	4	106374100	splice site	probably null
R6370:Usp24	UTSW	4	106380521	missense	probably null	0.20
R6630:Usp24	UTSW	4	106387835	missense	possibly damaging	0.69
R6754:Usp24	UTSW	4	106360420	missense	probably damaging	1.00
R7027:Usp24	UTSW	4	106362244	missense	probably benign	0.21
R7088:Usp24	UTSW	4	106387546	missense	probably damaging	1.00
R7129:Usp24	UTSW	4	106362215	missense	probably damaging	1.00
R7131:Usp24	UTSW	4	106382303	missense	possibly damaging	0.69
R7156:Usp24	UTSW	4	106387919	critical splice donor site	probably null
R7174:Usp24	UTSW	4	106362681	splice site	probably null
R7236:Usp24	UTSW	4	106406305	splice site	probably null
R7403:Usp24	UTSW	4	106407035	missense	possibly damaging	0.79
R7475:Usp24	UTSW	4	106342353	missense	possibly damaging	0.55
R7505:Usp24	UTSW	4	106379079	missense	probably damaging	1.00
R7782:Usp24	UTSW	4	106316574	missense	probably damaging	1.00
R7900:Usp24	UTSW	4	106409400	missense	probably damaging	1.00
R7933:Usp24	UTSW	4	106428489	missense	probably benign
R7940:Usp24	UTSW	4	106430544	missense	probably damaging	0.98
R8271:Usp24	UTSW	4	106428514	missense	probably damaging	0.98
R8348:Usp24	UTSW	4	106368736	missense	possibly damaging	0.82
R8448:Usp24	UTSW	4	106368736	missense	possibly damaging	0.82
R8483:Usp24	UTSW	4	106373756	missense	probably damaging	1.00
R8546:Usp24	UTSW	4	106402129	missense	probably benign	0.01
R8798:Usp24	UTSW	4	106379239	missense	probably benign	0.00
R8822:Usp24	UTSW	4	106412213	missense	probably benign	0.17
R8992:Usp24	UTSW	4	106377565	missense	probably benign	0.36
R9002:Usp24	UTSW	4	106418215	missense	possibly damaging	0.72
R9037:Usp24	UTSW	4	106379054	missense	probably damaging	0.99
R9068:Usp24	UTSW	4	106375678	missense	probably benign	0.09
R9096:Usp24	UTSW	4	106397311	missense	probably benign	0.00
R9180:Usp24	UTSW	4	106359050	missense	possibly damaging	0.71
R9199:Usp24	UTSW	4	106387484	missense	probably damaging	1.00
R9201:Usp24	UTSW	4	106420530	missense	probably benign	0.36
R9251:Usp24	UTSW	4	106360518	missense	probably benign	0.19
R9423:Usp24	UTSW	4	106431670	missense	probably damaging	1.00
R9459:Usp24	UTSW	4	106342358	missense	probably damaging	1.00
R9472:Usp24	UTSW	4	106403931	missense	probably benign	0.00
X0024:Usp24	UTSW	4	106360446	missense	probably benign	0.09
X0028:Usp24	UTSW	4	106368055	missense	probably benign	0.01
X0066:Usp24	UTSW	4	106355731	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- AGCTGCTGAACAAAGGGTCC -3'
(R):5'- CTTGTTCATCAGAGAACCCCAGTTG -3'

Sequencing Primer
(F):5'- GCTGAACAAAGGGTCCAGCAC -3'
(R):5'- CAGTTGGTGGAGGAGCTTTTGATC -3'

Posted On

2019-10-07