Incidental Mutation 'R7424:Ush1c'
ID575919
Institutional Source Beutler Lab
Gene Symbol Ush1c
Ensembl Gene ENSMUSG00000030838
Gene NameUSH1 protein network component harmonin
Synonymsharmonin, 2010016F01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7424 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location46195350-46238503 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46225555 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 131 (I131F)
Ref Sequence ENSEMBL: ENSMUSP00000134783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009667] [ENSMUST00000078680] [ENSMUST00000143155] [ENSMUST00000154292] [ENSMUST00000176371] [ENSMUST00000177212] [ENSMUST00000222454]
Predicted Effect probably benign
Transcript: ENSMUST00000009667
AA Change: I162F

PolyPhen 2 Score 0.420 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000009667
Gene: ENSMUSG00000030838
AA Change: I162F

DomainStartEndE-ValueType
PDZ 96 168 3.06e-19 SMART
low complexity region 190 203 N/A INTRINSIC
PDZ 220 292 5.62e-18 SMART
coiled coil region 301 376 N/A INTRINSIC
coiled coil region 419 478 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 562 596 N/A INTRINSIC
low complexity region 600 612 N/A INTRINSIC
PDZ 762 841 1.13e-13 SMART
low complexity region 846 860 N/A INTRINSIC
low complexity region 899 910 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078680
AA Change: I162F

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000077747
Gene: ENSMUSG00000030838
AA Change: I162F

DomainStartEndE-ValueType
PDZ 96 168 3.06e-19 SMART
low complexity region 190 203 N/A INTRINSIC
PDZ 220 292 5.62e-18 SMART
coiled coil region 301 376 N/A INTRINSIC
PDZ 458 537 1.13e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143155
AA Change: I162F

PolyPhen 2 Score 0.420 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119676
Gene: ENSMUSG00000030838
AA Change: I162F

DomainStartEndE-ValueType
PDZ 96 168 3.06e-19 SMART
low complexity region 190 203 N/A INTRINSIC
PDZ 220 292 5.62e-18 SMART
coiled coil region 301 376 N/A INTRINSIC
coiled coil region 419 478 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 562 596 N/A INTRINSIC
low complexity region 600 612 N/A INTRINSIC
PDZ 762 841 1.13e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154292
AA Change: I162F

PolyPhen 2 Score 0.420 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114494
Gene: ENSMUSG00000030838
AA Change: I162F

DomainStartEndE-ValueType
PDZ 96 168 3.06e-19 SMART
low complexity region 190 203 N/A INTRINSIC
PDZ 220 292 5.62e-18 SMART
coiled coil region 301 376 N/A INTRINSIC
coiled coil region 419 478 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 562 596 N/A INTRINSIC
low complexity region 600 612 N/A INTRINSIC
PDZ 762 841 1.13e-13 SMART
low complexity region 846 860 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176371
AA Change: I131F

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000134783
Gene: ENSMUSG00000030838
AA Change: I131F

DomainStartEndE-ValueType
PDZ 65 137 3.06e-19 SMART
low complexity region 159 172 N/A INTRINSIC
PDZ 189 261 5.62e-18 SMART
coiled coil region 270 345 N/A INTRINSIC
PDZ 427 506 1.13e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177212
AA Change: I162F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135734
Gene: ENSMUSG00000030838
AA Change: I162F

DomainStartEndE-ValueType
PDZ 96 168 3.06e-19 SMART
low complexity region 190 203 N/A INTRINSIC
PDZ 220 291 6.13e-10 SMART
low complexity region 313 325 N/A INTRINSIC
low complexity region 339 357 N/A INTRINSIC
PDZ 439 518 1.13e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222454
AA Change: I162F

PolyPhen 2 Score 0.420 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.3329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein that functions in the assembly of Usher protein complexes. The protein contains PDZ domains, a coiled-coil region with a bipartite nuclear localization signal and a PEST degradation sequence. Defects in this gene are the cause of Usher syndrome type 1C and non-syndromic sensorineural deafness autosomal recessive type 18. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mutations at this locus affect hearing and result in movement anomalies generally associated with vestibular mutants, such as head tossing and circling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik C T 8: 120,145,545 R71C probably damaging Het
Aanat A T 11: 116,595,629 probably benign Het
Ahrr G T 13: 74,257,545 S91* probably null Het
Ampd1 A T 3: 103,088,442 N223Y probably benign Het
Ankar T G 1: 72,680,058 N544T probably damaging Het
Ankk1 A G 9: 49,418,750 S302P possibly damaging Het
Bcr T C 10: 75,157,100 V809A probably benign Het
Bpifb2 A G 2: 153,890,540 N353S possibly damaging Het
Cyth1 A T 11: 118,184,009 probably null Het
Ddx5 A T 11: 106,782,180 N506K probably benign Het
Dnaja1 A T 4: 40,730,244 I239F probably benign Het
Ethe1 C T 7: 24,606,251 T141I probably damaging Het
Fam160b2 T C 14: 70,594,007 H29R probably damaging Het
Gdap2 A T 3: 100,202,066 I36F unknown Het
Gm13030 A T 4: 138,871,266 D115E unknown Het
Gm13103 C T 4: 143,853,209 P455S probably benign Het
Gm17019 A T 5: 15,029,372 L227Q probably damaging Het
Gm9195 T A 14: 72,435,777 E2517D possibly damaging Het
Gramd2 T A 9: 59,708,071 V39D possibly damaging Het
Hmcn1 C T 1: 150,630,266 W3836* probably null Het
Hspa14 C T 2: 3,489,041 D494N possibly damaging Het
Ifit2 A G 19: 34,573,198 N46S probably benign Het
Ifna6 A T 4: 88,827,807 E131V possibly damaging Het
Ift140 T C 17: 25,037,036 V504A possibly damaging Het
Irgc1 T C 7: 24,432,228 N388S probably damaging Het
Itgal T A 7: 127,317,365 V743E probably benign Het
Itih5 T C 2: 10,245,637 S716P probably damaging Het
Kcnab1 A T 3: 65,266,503 K78N possibly damaging Het
Kif1a A T 1: 93,054,317 V787E possibly damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Krt39 A T 11: 99,518,091 V293E probably damaging Het
Lrrn4 A G 2: 132,869,743 F720S possibly damaging Het
Map2 G A 1: 66,414,824 A958T possibly damaging Het
Map3k9 A G 12: 81,724,097 S906P probably benign Het
Mdc1 T C 17: 35,853,309 S1250P probably benign Het
Meltf G A 16: 31,884,946 V164I probably damaging Het
Mtap T G 4: 89,179,462 probably null Het
Mtus1 C A 8: 41,022,406 V184F probably damaging Het
Myh1 A T 11: 67,213,663 D1015V probably damaging Het
Ndrg1 T C 15: 66,944,938 probably null Het
Nkd1 G T 8: 88,585,175 V130L probably benign Het
Nsfl1c A G 2: 151,500,753 D81G probably benign Het
Nt5c1b T A 12: 10,381,391 probably null Het
Nucb1 T C 7: 45,498,778 K204E possibly damaging Het
Nwd1 T G 8: 72,675,173 M774R possibly damaging Het
Olfr165 A T 16: 19,407,194 V274E probably damaging Het
Olfr262 A T 19: 12,240,954 S236T possibly damaging Het
Olfr654 G C 7: 104,588,700 E299Q probably damaging Het
Pan3 T A 5: 147,536,272 probably null Het
Pcdh15 A T 10: 74,506,485 T1135S probably benign Het
Pfas A G 11: 69,000,092 I331T probably damaging Het
Plxna2 T A 1: 194,806,339 I1641N probably damaging Het
Ptar1 A T 19: 23,718,101 R311W probably damaging Het
Ranbp2 T G 10: 58,479,194 M1912R probably damaging Het
Rbm12 A G 2: 156,097,303 F350L possibly damaging Het
Sdhaf1 T C 7: 30,322,043 D96G probably benign Het
Serpinb6b T A 13: 32,968,667 M53K probably damaging Het
Sh2d6 A T 6: 72,517,164 L147Q probably benign Het
Slc19a2 T A 1: 164,260,876 C298S probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
St8sia2 T A 7: 73,960,902 Q211L possibly damaging Het
Sult2a2 T C 7: 13,734,897 I96T possibly damaging Het
Tab2 G T 10: 7,907,483 H678Q probably damaging Het
Tnfaip6 A G 2: 52,038,216 E14G probably benign Het
Trip11 A T 12: 101,885,198 L869H probably damaging Het
Tslp T C 18: 32,819,080 Y133H not run Het
Ttn T C 2: 76,740,990 I26520V probably damaging Het
Ttn A G 2: 76,932,143 V3374A unknown Het
Tubgcp2 T A 7: 140,007,924 I263F possibly damaging Het
Uaca A G 9: 60,870,110 E593G probably damaging Het
Unc13b C T 4: 43,172,235 T1021I unknown Het
Usp24 C A 4: 106,379,107 D997E probably benign Het
Usp54 T C 14: 20,577,040 T517A probably benign Het
Vmn1r151 A T 7: 22,499,080 M200K possibly damaging Het
Vmn2r43 T C 7: 8,255,329 D295G probably damaging Het
Vmn2r70 G A 7: 85,563,868 P444S probably damaging Het
Vmn2r85 G T 10: 130,418,980 P612T probably damaging Het
Vps13d A T 4: 145,148,747 V1736D Het
Zbtb11 A T 16: 55,990,487 H336L probably benign Het
Other mutations in Ush1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ush1c APN 7 46196770 missense probably benign 0.00
IGL01074:Ush1c APN 7 46225250 splice site probably benign
IGL01099:Ush1c APN 7 46205262 missense probably damaging 0.99
IGL01107:Ush1c APN 7 46209901 missense probably damaging 1.00
IGL01446:Ush1c APN 7 46208956 missense possibly damaging 0.86
IGL02267:Ush1c APN 7 46209298 missense possibly damaging 0.92
IGL02307:Ush1c APN 7 46197188 splice site probably benign
IGL02448:Ush1c APN 7 46209137 missense possibly damaging 0.51
IGL02485:Ush1c APN 7 46229250 missense probably damaging 0.99
IGL02896:Ush1c APN 7 46198415 missense probably benign 0.00
IGL03031:Ush1c APN 7 46224937 splice site probably benign
R0085:Ush1c UTSW 7 46225555 missense probably benign 0.09
R0328:Ush1c UTSW 7 46225448 splice site probably benign
R0574:Ush1c UTSW 7 46196804 missense possibly damaging 0.68
R0600:Ush1c UTSW 7 46224908 missense probably benign 0.00
R1187:Ush1c UTSW 7 46208914 missense probably benign 0.01
R1406:Ush1c UTSW 7 46225541 critical splice donor site probably null
R1406:Ush1c UTSW 7 46225541 critical splice donor site probably null
R1716:Ush1c UTSW 7 46195728 missense probably benign 0.18
R1727:Ush1c UTSW 7 46209231 missense probably damaging 1.00
R1822:Ush1c UTSW 7 46209901 missense probably damaging 1.00
R1864:Ush1c UTSW 7 46219392 nonsense probably null
R2000:Ush1c UTSW 7 46221433 missense probably damaging 0.99
R2063:Ush1c UTSW 7 46229481 missense probably damaging 1.00
R2068:Ush1c UTSW 7 46229481 missense probably damaging 1.00
R2944:Ush1c UTSW 7 46200982 missense probably damaging 1.00
R4042:Ush1c UTSW 7 46221528 missense probably damaging 0.97
R4043:Ush1c UTSW 7 46221528 missense probably damaging 0.97
R4108:Ush1c UTSW 7 46198445 missense probably damaging 1.00
R4823:Ush1c UTSW 7 46195733 missense probably benign 0.00
R4862:Ush1c UTSW 7 46229240 missense probably damaging 1.00
R5534:Ush1c UTSW 7 46221423 missense probably damaging 1.00
R5922:Ush1c UTSW 7 46204128 critical splice donor site probably null
R6249:Ush1c UTSW 7 46214959 missense probably damaging 1.00
R6475:Ush1c UTSW 7 46229219 missense probably damaging 0.99
R6485:Ush1c UTSW 7 46209110 missense probably benign
R6667:Ush1c UTSW 7 46225624 missense probably damaging 1.00
R7177:Ush1c UTSW 7 46229219 missense probably damaging 0.99
R7419:Ush1c UTSW 7 46229255 missense probably damaging 1.00
R7811:Ush1c UTSW 7 46205286 nonsense probably null
R7862:Ush1c UTSW 7 46221424 missense probably damaging 0.99
R7945:Ush1c UTSW 7 46221424 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTAGATCCCAGGACTCTTGGC -3'
(R):5'- GCTTTTGCTTGATGACAGCCC -3'

Sequencing Primer
(F):5'- ACTCTTGGCCTAGAGGAGAC -3'
(R):5'- CCAGGTAGGGGATGAAATT -3'
Posted On2019-10-07