Incidental Mutation 'R7424:St8sia2'
ID575920
Institutional Source Beutler Lab
Gene Symbol St8sia2
Ensembl Gene ENSMUSG00000025789
Gene NameST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2
SynonymsSiat8b, ST8SiaII
Accession Numbers

Ncbi RefSeq: NM_009181.2; MGI:106020

Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R7424 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location73939119-74013690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73960902 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 211 (Q211L)
Ref Sequence ENSEMBL: ENSMUSP00000026896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026896] [ENSMUST00000191970]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026896
AA Change: Q211L

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000026896
Gene: ENSMUSG00000025789
AA Change: Q211L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 25 39 N/A INTRINSIC
Pfam:Glyco_transf_29 109 369 2.7e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191970
AA Change: Q190L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141307
Gene: ENSMUSG00000025789
AA Change: Q190L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 25 38 N/A INTRINSIC
Pfam:Glyco_transf_29 84 206 5.8e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype Strain: 3051219
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane protein that is thought to catalyze the transfer of sialic acid from CMP-sialic acid to N-linked oligosaccharides and glycoproteins. The encoded protein may be found in the Golgi apparatus and may be involved in the production of polysialic acid, a modulator of the adhesive properties of neural cell adhesion molecule (NCAM1). This protein is a member of glycosyltransferase family 29. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display abnormal mossy fiber morphology, increased exploration in new environment and impaired fear responses. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik C T 8: 120,145,545 R71C probably damaging Het
Aanat A T 11: 116,595,629 probably benign Het
Ahrr G T 13: 74,257,545 S91* probably null Het
Ampd1 A T 3: 103,088,442 N223Y probably benign Het
Ankar T G 1: 72,680,058 N544T probably damaging Het
Ankk1 A G 9: 49,418,750 S302P possibly damaging Het
Bcr T C 10: 75,157,100 V809A probably benign Het
Bpifb2 A G 2: 153,890,540 N353S possibly damaging Het
Ddx5 A T 11: 106,782,180 N506K probably benign Het
Dnaja1 A T 4: 40,730,244 I239F probably benign Het
Ethe1 C T 7: 24,606,251 T141I probably damaging Het
Fam160b2 T C 14: 70,594,007 H29R probably damaging Het
Gdap2 A T 3: 100,202,066 I36F unknown Het
Gm13030 A T 4: 138,871,266 D115E unknown Het
Gm13103 C T 4: 143,853,209 P455S probably benign Het
Gm17019 A T 5: 15,029,372 L227Q probably damaging Het
Gm9195 T A 14: 72,435,777 E2517D possibly damaging Het
Gramd2 T A 9: 59,708,071 V39D possibly damaging Het
Hmcn1 C T 1: 150,630,266 W3836* probably null Het
Hspa14 C T 2: 3,489,041 D494N possibly damaging Het
Ifit2 A G 19: 34,573,198 N46S probably benign Het
Ifna6 A T 4: 88,827,807 E131V possibly damaging Het
Ift140 T C 17: 25,037,036 V504A possibly damaging Het
Irgc1 T C 7: 24,432,228 N388S probably damaging Het
Itgal T A 7: 127,317,365 V743E probably benign Het
Itih5 T C 2: 10,245,637 S716P probably damaging Het
Kcnab1 A T 3: 65,266,503 K78N possibly damaging Het
Kif1a A T 1: 93,054,317 V787E possibly damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Krt39 A T 11: 99,518,091 V293E probably damaging Het
Lrrn4 A G 2: 132,869,743 F720S possibly damaging Het
Map2 G A 1: 66,414,824 A958T possibly damaging Het
Map3k9 A G 12: 81,724,097 S906P probably benign Het
Mdc1 T C 17: 35,853,309 S1250P probably benign Het
Meltf G A 16: 31,884,946 V164I probably damaging Het
Mtus1 C A 8: 41,022,406 V184F probably damaging Het
Myh1 A T 11: 67,213,663 D1015V probably damaging Het
Nkd1 G T 8: 88,585,175 V130L probably benign Het
Nsfl1c A G 2: 151,500,753 D81G probably benign Het
Nucb1 T C 7: 45,498,778 K204E possibly damaging Het
Nwd1 T G 8: 72,675,173 M774R possibly damaging Het
Olfr165 A T 16: 19,407,194 V274E probably damaging Het
Olfr262 A T 19: 12,240,954 S236T possibly damaging Het
Olfr654 G C 7: 104,588,700 E299Q probably damaging Het
Pcdh15 A T 10: 74,506,485 T1135S probably benign Het
Pfas A G 11: 69,000,092 I331T probably damaging Het
Plxna2 T A 1: 194,806,339 I1641N probably damaging Het
Ptar1 A T 19: 23,718,101 R311W probably damaging Het
Ranbp2 T G 10: 58,479,194 M1912R probably damaging Het
Rbm12 A G 2: 156,097,303 F350L possibly damaging Het
Sdhaf1 T C 7: 30,322,043 D96G probably benign Het
Serpinb6b T A 13: 32,968,667 M53K probably damaging Het
Sh2d6 A T 6: 72,517,164 L147Q probably benign Het
Slc19a2 T A 1: 164,260,876 C298S probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Sult2a2 T C 7: 13,734,897 I96T possibly damaging Het
Tab2 G T 10: 7,907,483 H678Q probably damaging Het
Tnfaip6 A G 2: 52,038,216 E14G probably benign Het
Trip11 A T 12: 101,885,198 L869H probably damaging Het
Tslp T C 18: 32,819,080 Y133H not run Het
Ttn T C 2: 76,740,990 I26520V probably damaging Het
Ttn A G 2: 76,932,143 V3374A unknown Het
Tubgcp2 T A 7: 140,007,924 I263F possibly damaging Het
Uaca A G 9: 60,870,110 E593G probably damaging Het
Unc13b C T 4: 43,172,235 T1021I unknown Het
Ush1c T A 7: 46,225,555 I131F probably benign Het
Usp24 C A 4: 106,379,107 D997E probably benign Het
Usp54 T C 14: 20,577,040 T517A probably benign Het
Vmn1r151 A T 7: 22,499,080 M200K possibly damaging Het
Vmn2r43 T C 7: 8,255,329 D295G probably damaging Het
Vmn2r70 G A 7: 85,563,868 P444S probably damaging Het
Vmn2r85 G T 10: 130,418,980 P612T probably damaging Het
Vps13d A T 4: 145,148,747 V1736D Het
Zbtb11 A T 16: 55,990,487 H336L probably benign Het
Other mutations in St8sia2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02161:St8sia2 APN 7 73976682 missense probably benign 0.00
IGL02261:St8sia2 APN 7 73966846 missense probably damaging 1.00
IGL02941:St8sia2 APN 7 73976649 intron probably benign
IGL02971:St8sia2 APN 7 73966811 missense probably damaging 1.00
IGL03147:St8sia2 UTSW 7 73966819 missense probably damaging 1.00
R0052:St8sia2 UTSW 7 73943290 nonsense probably null
R0052:St8sia2 UTSW 7 73943290 nonsense probably null
R0052:St8sia2 UTSW 7 73971952 missense probably damaging 1.00
R0733:St8sia2 UTSW 7 73960840 missense probably benign
R1202:St8sia2 UTSW 7 73972035 missense probably benign 0.43
R1419:St8sia2 UTSW 7 73966994 nonsense probably null
R1962:St8sia2 UTSW 7 73943309 missense probably damaging 1.00
R2051:St8sia2 UTSW 7 73943202 missense possibly damaging 0.91
R4106:St8sia2 UTSW 7 73960761 missense probably damaging 1.00
R4989:St8sia2 UTSW 7 73966961 missense possibly damaging 0.75
R5541:St8sia2 UTSW 7 73966900 missense probably benign 0.00
R5859:St8sia2 UTSW 7 73966906 missense probably damaging 1.00
R6029:St8sia2 UTSW 7 73960710 missense possibly damaging 0.96
R6260:St8sia2 UTSW 7 73976693 missense possibly damaging 0.56
R6416:St8sia2 UTSW 7 73971921 missense probably damaging 1.00
R7371:St8sia2 UTSW 7 73966927 missense probably damaging 0.99
R7763:St8sia2 UTSW 7 73943321 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCTTAGCAATGAGAGCTAC -3'
(R):5'- CCTGCATCTCTGAGGAAGAAG -3'

Sequencing Primer
(F):5'- AGAGCTACTCACCCTCGGACTG -3'
(R):5'- CATCTCTGAGGAAGAAGACAGAAGC -3'
Posted On2019-10-07