Incidental Mutation 'R7424:Olfr654'
ID575922
Institutional Source Beutler Lab
Gene Symbol Olfr654
Ensembl Gene ENSMUSG00000073925
Gene Nameolfactory receptor 654
SynonymsGA_x6K02T2PBJ9-7215221-7216195, MOR38-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R7424 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location104587025-104590718 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 104588700 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glutamine at position 299 (E299Q)
Ref Sequence ENSEMBL: ENSMUSP00000149640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098173] [ENSMUST00000210457] [ENSMUST00000213984] [ENSMUST00000215585] [ENSMUST00000217466]
Predicted Effect probably damaging
Transcript: ENSMUST00000098173
AA Change: E316Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095775
Gene: ENSMUSG00000073925
AA Change: E316Q

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
Pfam:7TM_GPCR_Srbc 43 176 2.5e-8 PFAM
Pfam:7tm_4 49 328 1.7e-103 PFAM
Pfam:7TM_GPCR_Srsx 53 325 1.6e-7 PFAM
Pfam:7tm_1 59 310 9.2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210457
AA Change: E299Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000213984
AA Change: E299Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215585
Predicted Effect probably benign
Transcript: ENSMUST00000217466
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik C T 8: 120,145,545 R71C probably damaging Het
Aanat A T 11: 116,595,629 probably benign Het
Ahrr G T 13: 74,257,545 S91* probably null Het
Ampd1 A T 3: 103,088,442 N223Y probably benign Het
Ankar T G 1: 72,680,058 N544T probably damaging Het
Ankk1 A G 9: 49,418,750 S302P possibly damaging Het
Bcr T C 10: 75,157,100 V809A probably benign Het
Bpifb2 A G 2: 153,890,540 N353S possibly damaging Het
Ddx5 A T 11: 106,782,180 N506K probably benign Het
Dnaja1 A T 4: 40,730,244 I239F probably benign Het
Ethe1 C T 7: 24,606,251 T141I probably damaging Het
Fam160b2 T C 14: 70,594,007 H29R probably damaging Het
Gdap2 A T 3: 100,202,066 I36F unknown Het
Gm13030 A T 4: 138,871,266 D115E unknown Het
Gm13103 C T 4: 143,853,209 P455S probably benign Het
Gm17019 A T 5: 15,029,372 L227Q probably damaging Het
Gm9195 T A 14: 72,435,777 E2517D possibly damaging Het
Gramd2 T A 9: 59,708,071 V39D possibly damaging Het
Hmcn1 C T 1: 150,630,266 W3836* probably null Het
Hspa14 C T 2: 3,489,041 D494N possibly damaging Het
Ifit2 A G 19: 34,573,198 N46S probably benign Het
Ifna6 A T 4: 88,827,807 E131V possibly damaging Het
Ift140 T C 17: 25,037,036 V504A possibly damaging Het
Irgc1 T C 7: 24,432,228 N388S probably damaging Het
Itgal T A 7: 127,317,365 V743E probably benign Het
Itih5 T C 2: 10,245,637 S716P probably damaging Het
Kcnab1 A T 3: 65,266,503 K78N possibly damaging Het
Kif1a A T 1: 93,054,317 V787E possibly damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Krt39 A T 11: 99,518,091 V293E probably damaging Het
Lrrn4 A G 2: 132,869,743 F720S possibly damaging Het
Map2 G A 1: 66,414,824 A958T possibly damaging Het
Map3k9 A G 12: 81,724,097 S906P probably benign Het
Mdc1 T C 17: 35,853,309 S1250P probably benign Het
Meltf G A 16: 31,884,946 V164I probably damaging Het
Mtus1 C A 8: 41,022,406 V184F probably damaging Het
Myh1 A T 11: 67,213,663 D1015V probably damaging Het
Nkd1 G T 8: 88,585,175 V130L probably benign Het
Nsfl1c A G 2: 151,500,753 D81G probably benign Het
Nucb1 T C 7: 45,498,778 K204E possibly damaging Het
Nwd1 T G 8: 72,675,173 M774R possibly damaging Het
Olfr165 A T 16: 19,407,194 V274E probably damaging Het
Olfr262 A T 19: 12,240,954 S236T possibly damaging Het
Pcdh15 A T 10: 74,506,485 T1135S probably benign Het
Pfas A G 11: 69,000,092 I331T probably damaging Het
Plxna2 T A 1: 194,806,339 I1641N probably damaging Het
Ptar1 A T 19: 23,718,101 R311W probably damaging Het
Ranbp2 T G 10: 58,479,194 M1912R probably damaging Het
Rbm12 A G 2: 156,097,303 F350L possibly damaging Het
Sdhaf1 T C 7: 30,322,043 D96G probably benign Het
Serpinb6b T A 13: 32,968,667 M53K probably damaging Het
Sh2d6 A T 6: 72,517,164 L147Q probably benign Het
Slc19a2 T A 1: 164,260,876 C298S probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
St8sia2 T A 7: 73,960,902 Q211L possibly damaging Het
Sult2a2 T C 7: 13,734,897 I96T possibly damaging Het
Tab2 G T 10: 7,907,483 H678Q probably damaging Het
Tnfaip6 A G 2: 52,038,216 E14G probably benign Het
Trip11 A T 12: 101,885,198 L869H probably damaging Het
Tslp T C 18: 32,819,080 Y133H not run Het
Ttn T C 2: 76,740,990 I26520V probably damaging Het
Ttn A G 2: 76,932,143 V3374A unknown Het
Tubgcp2 T A 7: 140,007,924 I263F possibly damaging Het
Uaca A G 9: 60,870,110 E593G probably damaging Het
Unc13b C T 4: 43,172,235 T1021I unknown Het
Ush1c T A 7: 46,225,555 I131F probably benign Het
Usp24 C A 4: 106,379,107 D997E probably benign Het
Usp54 T C 14: 20,577,040 T517A probably benign Het
Vmn1r151 A T 7: 22,499,080 M200K possibly damaging Het
Vmn2r43 T C 7: 8,255,329 D295G probably damaging Het
Vmn2r70 G A 7: 85,563,868 P444S probably damaging Het
Vmn2r85 G T 10: 130,418,980 P612T probably damaging Het
Vps13d A T 4: 145,148,747 V1736D Het
Zbtb11 A T 16: 55,990,487 H336L probably benign Het
Other mutations in Olfr654
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Olfr654 APN 7 104587860 missense probably damaging 1.00
IGL01677:Olfr654 APN 7 104588145 missense probably damaging 0.97
IGL01807:Olfr654 APN 7 104587884 missense probably damaging 1.00
IGL03113:Olfr654 APN 7 104588733 missense probably benign 0.01
R0504:Olfr654 UTSW 7 104588475 nonsense probably null
R0647:Olfr654 UTSW 7 104588115 missense probably damaging 1.00
R0941:Olfr654 UTSW 7 104588338 missense probably damaging 1.00
R0945:Olfr654 UTSW 7 104588672 missense probably damaging 1.00
R1423:Olfr654 UTSW 7 104588475 nonsense probably null
R1860:Olfr654 UTSW 7 104587905 missense probably damaging 0.98
R2872:Olfr654 UTSW 7 104588493 missense possibly damaging 0.87
R2872:Olfr654 UTSW 7 104588493 missense possibly damaging 0.87
R4082:Olfr654 UTSW 7 104588623 missense probably damaging 1.00
R4760:Olfr654 UTSW 7 104588489 missense probably benign 0.32
R4787:Olfr654 UTSW 7 104587960 missense probably benign
R4969:Olfr654 UTSW 7 104588523 missense probably damaging 1.00
R5186:Olfr654 UTSW 7 104588211 missense probably damaging 1.00
R5706:Olfr654 UTSW 7 104587890 missense probably benign 0.02
R6582:Olfr654 UTSW 7 104588011 missense probably damaging 1.00
R7076:Olfr654 UTSW 7 104588223 missense probably damaging 1.00
R7155:Olfr654 UTSW 7 104588557 missense possibly damaging 0.88
R7559:Olfr654 UTSW 7 104587880 missense probably damaging 1.00
R7722:Olfr654 UTSW 7 104588298 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- ACGAGCTATCATGCATCTCTC -3'
(R):5'- CATGGCTGCTAATCTGACATTTC -3'

Sequencing Primer
(F):5'- GAGCTATCATGCATCTCTCTTCCAAG -3'
(R):5'- TCCCCTAGACACTTACCAT -3'
Posted On2019-10-07