Mutagenetix > Incidental Mutation

Incidental Mutation 'R7424:Itgal'

575923

Institutional Source

Beutler Lab

Gene Symbol

Itgal

Ensembl Gene

ENSMUSG00000030830

Gene Name

integrin alpha L

Synonyms

LFA-1, Ly-21, Cd11a, Ly-15

MMRRC Submission

045502-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.143) question?

Stock #

R7424 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

127296260-127335138 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 127317365 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 743 (V743E)

Ref Sequence

ENSEMBL: ENSMUSP00000101913 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106306] [ENSMUST00000117762] [ENSMUST00000118405] [ENSMUST00000120857] [ENSMUST00000170971]

AlphaFold

P24063

Predicted Effect

probably benign
Transcript: ENSMUST00000106306
AA Change: V743E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000101913
Gene: ENSMUSG00000030830
AA Change: V743E

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Int_alpha	38	81	5.01e0	SMART
VWA	151	327	2.68e-32	SMART
Int_alpha	398	450	1.27e-6	SMART
Int_alpha	454	509	9.6e-7	SMART
Int_alpha	515	568	3.58e-15	SMART
Int_alpha	575	624	1.28e1	SMART
low complexity region	1043	1059	N/A	INTRINSIC
transmembrane domain	1087	1109	N/A	INTRINSIC
Pfam:Integrin_alpha	1110	1124	5.8e-7	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000117762

SMART Domains

Protein: ENSMUSP00000113946
Gene: ENSMUSG00000030830

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Int_alpha	38	81	5.01e0	SMART
VWA	151	327	2.68e-32	SMART
Int_alpha	398	450	1.27e-6	SMART
Int_alpha	454	509	9.6e-7	SMART
Int_alpha	515	568	3.58e-15	SMART
Int_alpha	575	624	1.28e1	SMART
low complexity region	1042	1058	N/A	INTRINSIC
transmembrane domain	1086	1108	N/A	INTRINSIC
Pfam:Integrin_alpha	1109	1123	5.8e-7	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000118405

SMART Domains

Protein: ENSMUSP00000112591
Gene: ENSMUSG00000030830

Domain	Start	End	E-Value	Type
Int_alpha	2	54	4.21e-3	SMART
Int_alpha	58	113	9.6e-7	SMART
Int_alpha	119	172	3.58e-15	SMART
Int_alpha	179	228	1.28e1	SMART
low complexity region	646	662	N/A	INTRINSIC
transmembrane domain	690	712	N/A	INTRINSIC
Pfam:Integrin_alpha	713	727	2.1e-7	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000120857

SMART Domains

Protein: ENSMUSP00000113396
Gene: ENSMUSG00000030830

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Int_alpha	38	81	5.01e0	SMART
VWA	151	327	2.68e-32	SMART
Int_alpha	398	450	1.27e-6	SMART
Int_alpha	454	509	9.6e-7	SMART
Int_alpha	515	568	3.58e-15	SMART
Int_alpha	575	624	1.28e1	SMART
low complexity region	1042	1058	N/A	INTRINSIC
transmembrane domain	1086	1108	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000170971

SMART Domains

Protein: ENSMUSP00000131847
Gene: ENSMUSG00000030830

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Int_alpha	38	81	5.01e0	SMART
VWA	151	327	2.68e-32	SMART
Int_alpha	398	450	1.27e-6	SMART
Int_alpha	454	509	9.6e-7	SMART
Int_alpha	515	568	3.58e-15	SMART
Int_alpha	575	624	1.28e1	SMART
low complexity region	1042	1058	N/A	INTRINSIC
transmembrane domain	1086	1108	N/A	INTRINSIC
Pfam:Integrin_alpha	1109	1123	1.2e-6	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

99% (76/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ITGAL encodes the integrin alpha L chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form the integrin lymphocyte function-associated antigen-1 (LFA-1), which is expressed on all leukocytes. LFA-1 plays a central role in leukocyte intercellular adhesion through interactions with its ligands, ICAMs 1-3 (intercellular adhesion molecules 1 through 3), and also functions in lymphocyte costimulatory signaling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mutations of this gene lead to increased leukocyte cell number, alter T cell activation, leukocyte migration and adhesion, spleen and lymph node morphology, and may affect humoral immune responses, metastatic potential, and susceptibility to endotoxin shock. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430548M08Rik	C	T	8: 120,145,545	R71C	probably damaging	Het
Aanat	A	T	11: 116,595,629		probably benign	Het
Ahrr	G	T	13: 74,257,545	S91*	probably null	Het
Ampd1	A	T	3: 103,088,442	N223Y	probably benign	Het
Ankar	T	G	1: 72,680,058	N544T	probably damaging	Het
Ankk1	A	G	9: 49,418,750	S302P	possibly damaging	Het
Bcr	T	C	10: 75,157,100	V809A	probably benign	Het
Bpifb2	A	G	2: 153,890,540	N353S	possibly damaging	Het
Cyth1	A	T	11: 118,184,009		probably null	Het
Ddx5	A	T	11: 106,782,180	N506K	probably benign	Het
Dnaja1	A	T	4: 40,730,244	I239F	probably benign	Het
Ethe1	C	T	7: 24,606,251	T141I	probably damaging	Het
Fam160b2	T	C	14: 70,594,007	H29R	probably damaging	Het
Gdap2	A	T	3: 100,202,066	I36F	unknown	Het
Gm13030	A	T	4: 138,871,266	D115E	unknown	Het
Gm13103	C	T	4: 143,853,209	P455S	probably benign	Het
Gm17019	A	T	5: 15,029,372	L227Q	probably damaging	Het
Gm9195	T	A	14: 72,435,777	E2517D	possibly damaging	Het
Gramd2	T	A	9: 59,708,071	V39D	possibly damaging	Het
Hmcn1	C	T	1: 150,630,266	W3836*	probably null	Het
Hspa14	C	T	2: 3,489,041	D494N	possibly damaging	Het
Ifit2	A	G	19: 34,573,198	N46S	probably benign	Het
Ifna6	A	T	4: 88,827,807	E131V	possibly damaging	Het
Ift140	T	C	17: 25,037,036	V504A	possibly damaging	Het
Irgc1	T	C	7: 24,432,228	N388S	probably damaging	Het
Itih5	T	C	2: 10,245,637	S716P	probably damaging	Het
Kcnab1	A	T	3: 65,266,503	K78N	possibly damaging	Het
Kif1a	A	T	1: 93,054,317	V787E	possibly damaging	Het
Krt15	A	T	11: 100,135,560	V100E	possibly damaging	Het
Krt39	A	T	11: 99,518,091	V293E	probably damaging	Het
Lrrn4	A	G	2: 132,869,743	F720S	possibly damaging	Het
Map2	G	A	1: 66,414,824	A958T	possibly damaging	Het
Map3k9	A	G	12: 81,724,097	S906P	probably benign	Het
Mdc1	T	C	17: 35,853,309	S1250P	probably benign	Het
Meltf	G	A	16: 31,884,946	V164I	probably damaging	Het
Mtap	T	G	4: 89,179,462		probably null	Het
Mtus1	C	A	8: 41,022,406	V184F	probably damaging	Het
Myh1	A	T	11: 67,213,663	D1015V	probably damaging	Het
Ndrg1	T	C	15: 66,944,938		probably null	Het
Nkd1	G	T	8: 88,585,175	V130L	probably benign	Het
Nsfl1c	A	G	2: 151,500,753	D81G	probably benign	Het
Nt5c1b	T	A	12: 10,381,391		probably null	Het
Nucb1	T	C	7: 45,498,778	K204E	possibly damaging	Het
Nwd1	T	G	8: 72,675,173	M774R	possibly damaging	Het
Olfr165	A	T	16: 19,407,194	V274E	probably damaging	Het
Olfr262	A	T	19: 12,240,954	S236T	possibly damaging	Het
Olfr654	G	C	7: 104,588,700	E299Q	probably damaging	Het
Pan3	T	A	5: 147,536,272		probably null	Het
Pcdh15	A	T	10: 74,506,485	T1135S	probably benign	Het
Pfas	A	G	11: 69,000,092	I331T	probably damaging	Het
Plxna2	T	A	1: 194,806,339	I1641N	probably damaging	Het
Ptar1	A	T	19: 23,718,101	R311W	probably damaging	Het
Ranbp2	T	G	10: 58,479,194	M1912R	probably damaging	Het
Rbm12	A	G	2: 156,097,303	F350L	possibly damaging	Het
Sdhaf1	T	C	7: 30,322,043	D96G	probably benign	Het
Serpinb6b	T	A	13: 32,968,667	M53K	probably damaging	Het
Sh2d6	A	T	6: 72,517,164	L147Q	probably benign	Het
Slc19a2	T	A	1: 164,260,876	C298S	probably benign	Het
Son	AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG	AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG	16: 91,660,334		probably benign	Het
St8sia2	T	A	7: 73,960,902	Q211L	possibly damaging	Het
Sult2a2	T	C	7: 13,734,897	I96T	possibly damaging	Het
Tab2	G	T	10: 7,907,483	H678Q	probably damaging	Het
Tnfaip6	A	G	2: 52,038,216	E14G	probably benign	Het
Trip11	A	T	12: 101,885,198	L869H	probably damaging	Het
Tslp	T	C	18: 32,819,080	Y133H	not run	Het
Ttn	T	C	2: 76,740,990	I26520V	probably damaging	Het
Ttn	A	G	2: 76,932,143	V3374A	unknown	Het
Tubgcp2	T	A	7: 140,007,924	I263F	possibly damaging	Het
Uaca	A	G	9: 60,870,110	E593G	probably damaging	Het
Unc13b	C	T	4: 43,172,235	T1021I	unknown	Het
Ush1c	T	A	7: 46,225,555	I131F	probably benign	Het
Usp24	C	A	4: 106,379,107	D997E	probably benign	Het
Usp54	T	C	14: 20,577,040	T517A	probably benign	Het
Vmn1r151	A	T	7: 22,499,080	M200K	possibly damaging	Het
Vmn2r43	T	C	7: 8,255,329	D295G	probably damaging	Het
Vmn2r70	G	A	7: 85,563,868	P444S	probably damaging	Het
Vmn2r85	G	T	10: 130,418,980	P612T	probably damaging	Het
Vps13d	A	T	4: 145,148,747	V1736D		Het
Zbtb11	A	T	16: 55,990,487	H336L	probably benign	Het

Other mutations in Itgal

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00987:Itgal	APN	7	127302011	missense	probably damaging	0.99
IGL01300:Itgal	APN	7	127314118	missense	probably damaging	1.00
IGL01345:Itgal	APN	7	127300956	missense	possibly damaging	0.56
IGL01826:Itgal	APN	7	127302146	missense	probably benign	0.16
IGL02202:Itgal	APN	7	127330179	nonsense	probably null
IGL02212:Itgal	APN	7	127300980	missense	probably benign	0.00
IGL02513:Itgal	APN	7	127328672	missense	possibly damaging	0.78
IGL02608:Itgal	APN	7	127310244	missense	probably damaging	1.00
IGL02946:Itgal	APN	7	127314368	missense	probably damaging	0.99
sunglow	UTSW	7	127328747	missense	probably null	0.89
R0069:Itgal	UTSW	7	127310331	missense	probably benign	0.44
R0069:Itgal	UTSW	7	127310331	missense	probably benign	0.44
R0107:Itgal	UTSW	7	127328559	splice site	probably benign
R0331:Itgal	UTSW	7	127306681	splice site	probably null
R0350:Itgal	UTSW	7	127322081	missense	probably damaging	1.00
R0380:Itgal	UTSW	7	127310751	nonsense	probably null
R0537:Itgal	UTSW	7	127311273	missense	possibly damaging	0.61
R0546:Itgal	UTSW	7	127310314	missense	probably benign	0.00
R0594:Itgal	UTSW	7	127314060	missense	probably damaging	1.00
R1167:Itgal	UTSW	7	127300939	missense	probably damaging	1.00
R1377:Itgal	UTSW	7	127321917	missense	probably damaging	1.00
R1575:Itgal	UTSW	7	127300888	critical splice acceptor site	probably null
R1690:Itgal	UTSW	7	127302117	missense	possibly damaging	0.56
R1693:Itgal	UTSW	7	127305281	missense	probably damaging	1.00
R1702:Itgal	UTSW	7	127305025	missense	probably benign	0.00
R1720:Itgal	UTSW	7	127306927	missense	probably benign	0.00
R1774:Itgal	UTSW	7	127309622	critical splice donor site	probably null
R1824:Itgal	UTSW	7	127314060	missense	probably damaging	1.00
R1878:Itgal	UTSW	7	127310671	missense	probably benign	0.44
R1951:Itgal	UTSW	7	127330145	missense	probably damaging	1.00
R2265:Itgal	UTSW	7	127306701	missense	possibly damaging	0.63
R2267:Itgal	UTSW	7	127306701	missense	possibly damaging	0.63
R2269:Itgal	UTSW	7	127306701	missense	possibly damaging	0.63
R2276:Itgal	UTSW	7	127328747	missense	probably null	0.89
R2570:Itgal	UTSW	7	127314096	missense	probably damaging	1.00
R3925:Itgal	UTSW	7	127324537	splice site	probably benign
R4225:Itgal	UTSW	7	127305312	missense	probably damaging	1.00
R4377:Itgal	UTSW	7	127328281	missense	probably benign	0.00
R4466:Itgal	UTSW	7	127328512	missense	possibly damaging	0.93
R4579:Itgal	UTSW	7	127305294	missense	possibly damaging	0.83
R4656:Itgal	UTSW	7	127322553	missense	probably damaging	1.00
R4771:Itgal	UTSW	7	127328233	missense	probably damaging	1.00
R5012:Itgal	UTSW	7	127299630	critical splice donor site	probably null
R5328:Itgal	UTSW	7	127311675	critical splice donor site	probably null
R5365:Itgal	UTSW	7	127305350	missense	probably damaging	0.98
R5579:Itgal	UTSW	7	127306929	missense	probably benign	0.10
R5849:Itgal	UTSW	7	127317320	missense	probably benign	0.27
R5955:Itgal	UTSW	7	127304989	missense	possibly damaging	0.82
R6254:Itgal	UTSW	7	127325203	missense	probably damaging	1.00
R6269:Itgal	UTSW	7	127330217	missense	probably null	1.00
R6520:Itgal	UTSW	7	127330331	missense	probably benign	0.01
R6541:Itgal	UTSW	7	127311562	missense	probably damaging	0.99
R7049:Itgal	UTSW	7	127296401	unclassified	probably benign
R7168:Itgal	UTSW	7	127330213	missense	probably benign
R7419:Itgal	UTSW	7	127306875	missense	probably benign	0.01
R7454:Itgal	UTSW	7	127327764	missense	probably benign	0.00
R7567:Itgal	UTSW	7	127299788	missense	probably benign	0.00
R7696:Itgal	UTSW	7	127330184	missense	probably damaging	1.00
R7977:Itgal	UTSW	7	127328298	missense	possibly damaging	0.88
R7987:Itgal	UTSW	7	127328298	missense	possibly damaging	0.88
R8118:Itgal	UTSW	7	127311245	missense	probably benign	0.08
R8297:Itgal	UTSW	7	127330466	missense	unknown
R8418:Itgal	UTSW	7	127330282	missense	probably benign	0.02
R8477:Itgal	UTSW	7	127300933	missense	probably damaging	1.00
R8507:Itgal	UTSW	7	127329435	missense	probably benign	0.26
R8789:Itgal	UTSW	7	127305249	missense	probably benign	0.05
R8838:Itgal	UTSW	7	127311261	missense	probably damaging	1.00
R8881:Itgal	UTSW	7	127330369	missense	probably benign	0.11
R8923:Itgal	UTSW	7	127296361	unclassified	probably benign
R9070:Itgal	UTSW	7	127328701	missense	probably null	0.98
R9104:Itgal	UTSW	7	127311622	missense	probably damaging	1.00
R9173:Itgal	UTSW	7	127297617	critical splice acceptor site	probably null
R9179:Itgal	UTSW	7	127306711	missense	probably benign	0.33
R9407:Itgal	UTSW	7	127322624	critical splice donor site	probably null
R9545:Itgal	UTSW	7	127330250	missense	probably damaging	1.00
R9681:Itgal	UTSW	7	127330250	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGTATGCAGTAGAAATCAGTAAGGTC -3'
(R):5'- AACAGGCTCACTAAAGCGGC -3'

Sequencing Primer
(F):5'- GCAGTAGAAATCAGTAAGGTCTTAAC -3'
(R):5'- TAAAGCGGCCCTCCAGACTC -3'

Posted On

2019-10-07