Mutagenetix > Incidental Mutations

Incidental Mutation 'R7424:Tab2'

575932

Institutional Source

Beutler Lab

Gene Symbol

Tab2

Ensembl Gene

ENSMUSG00000015755

Gene Name

TGF-beta activated kinase 1/MAP3K7 binding protein 2

Synonyms

1110030N06Rik, Map3k7ip2, A530078N03Rik, Tak1 binding protein 2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7424 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

7905653-7956230 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 7907483 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 678 (H678Q)

Ref Sequence

ENSEMBL: ENSMUSP00000121266 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000146444] [ENSMUST00000147938]

PDB Structure

Crystal structure of the mouse TAB2-NZF in complex with Lys63-linked di-ubiquitin [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000146444
AA Change: H678Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000121266
Gene: ENSMUSG00000015755
AA Change: H678Q

Domain	Start	End	E-Value	Type
CUE	8	50	1.15e-10	SMART
low complexity region	286	311	N/A	INTRINSIC
coiled coil region	532	619	N/A	INTRINSIC
ZnF_RBZ	666	690	1.91e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000147938

SMART Domains

Protein: ENSMUSP00000119515
Gene: ENSMUSG00000015755

Domain	Start	End	E-Value	Type
CUE	8	50	1.15e-10	SMART
low complexity region	286	311	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

99% (76/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an activator of MAP3K7/TAK1, which is required for for the IL-1 induced activation of nuclear factor kappaB and MAPK8/JNK. This protein forms a kinase complex with TRAF6, MAP3K7 and TAB1, and it thus serves as an adaptor that links MAP3K7 and TRAF6. This protein, along with TAB1 and MAP3K7, also participates in the signal transduction induced by TNFSF11/RANKl through the activation of the receptor activator of NF-kappaB (TNFRSF11A/RANK), which may regulate the development and function of osteoclasts. Studies of the related mouse protein indicate that it functions to protect against liver damage caused by chemical stressors. Mutations in this gene cause congenital heart defects, multiple types, 2 (CHTD2). Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Embryos homozygous for a knock-out allele are viable up to E9.5. Embryos homozygous for a different knock-out allele are normal and viable up to E11.5 but become pale and anemic, exhibit liver hemorrhage and increased apoptosis of hepatoblasts, and die by E12.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430548M08Rik	C	T	8: 120,145,545	R71C	probably damaging	Het
Aanat	A	T	11: 116,595,629		probably benign	Het
Ahrr	G	T	13: 74,257,545	S91*	probably null	Het
Ampd1	A	T	3: 103,088,442	N223Y	probably benign	Het
Ankar	T	G	1: 72,680,058	N544T	probably damaging	Het
Ankk1	A	G	9: 49,418,750	S302P	possibly damaging	Het
Bcr	T	C	10: 75,157,100	V809A	probably benign	Het
Bpifb2	A	G	2: 153,890,540	N353S	possibly damaging	Het
Cyth1	A	T	11: 118,184,009		probably null	Het
Ddx5	A	T	11: 106,782,180	N506K	probably benign	Het
Dnaja1	A	T	4: 40,730,244	I239F	probably benign	Het
Ethe1	C	T	7: 24,606,251	T141I	probably damaging	Het
Fam160b2	T	C	14: 70,594,007	H29R	probably damaging	Het
Gdap2	A	T	3: 100,202,066	I36F	unknown	Het
Gm13030	A	T	4: 138,871,266	D115E	unknown	Het
Gm13103	C	T	4: 143,853,209	P455S	probably benign	Het
Gm17019	A	T	5: 15,029,372	L227Q	probably damaging	Het
Gm9195	T	A	14: 72,435,777	E2517D	possibly damaging	Het
Gramd2	T	A	9: 59,708,071	V39D	possibly damaging	Het
Hmcn1	C	T	1: 150,630,266	W3836*	probably null	Het
Hspa14	C	T	2: 3,489,041	D494N	possibly damaging	Het
Ifit2	A	G	19: 34,573,198	N46S	probably benign	Het
Ifna6	A	T	4: 88,827,807	E131V	possibly damaging	Het
Ift140	T	C	17: 25,037,036	V504A	possibly damaging	Het
Irgc1	T	C	7: 24,432,228	N388S	probably damaging	Het
Itgal	T	A	7: 127,317,365	V743E	probably benign	Het
Itih5	T	C	2: 10,245,637	S716P	probably damaging	Het
Kcnab1	A	T	3: 65,266,503	K78N	possibly damaging	Het
Kif1a	A	T	1: 93,054,317	V787E	possibly damaging	Het
Krt15	A	T	11: 100,135,560	V100E	possibly damaging	Het
Krt39	A	T	11: 99,518,091	V293E	probably damaging	Het
Lrrn4	A	G	2: 132,869,743	F720S	possibly damaging	Het
Map2	G	A	1: 66,414,824	A958T	possibly damaging	Het
Map3k9	A	G	12: 81,724,097	S906P	probably benign	Het
Mdc1	T	C	17: 35,853,309	S1250P	probably benign	Het
Meltf	G	A	16: 31,884,946	V164I	probably damaging	Het
Mtap	T	G	4: 89,179,462		probably null	Het
Mtus1	C	A	8: 41,022,406	V184F	probably damaging	Het
Myh1	A	T	11: 67,213,663	D1015V	probably damaging	Het
Ndrg1	T	C	15: 66,944,938		probably null	Het
Nkd1	G	T	8: 88,585,175	V130L	probably benign	Het
Nsfl1c	A	G	2: 151,500,753	D81G	probably benign	Het
Nt5c1b	T	A	12: 10,381,391		probably null	Het
Nucb1	T	C	7: 45,498,778	K204E	possibly damaging	Het
Nwd1	T	G	8: 72,675,173	M774R	possibly damaging	Het
Olfr165	A	T	16: 19,407,194	V274E	probably damaging	Het
Olfr262	A	T	19: 12,240,954	S236T	possibly damaging	Het
Olfr654	G	C	7: 104,588,700	E299Q	probably damaging	Het
Pan3	T	A	5: 147,536,272		probably null	Het
Pcdh15	A	T	10: 74,506,485	T1135S	probably benign	Het
Pfas	A	G	11: 69,000,092	I331T	probably damaging	Het
Plxna2	T	A	1: 194,806,339	I1641N	probably damaging	Het
Ptar1	A	T	19: 23,718,101	R311W	probably damaging	Het
Ranbp2	T	G	10: 58,479,194	M1912R	probably damaging	Het
Rbm12	A	G	2: 156,097,303	F350L	possibly damaging	Het
Sdhaf1	T	C	7: 30,322,043	D96G	probably benign	Het
Serpinb6b	T	A	13: 32,968,667	M53K	probably damaging	Het
Sh2d6	A	T	6: 72,517,164	L147Q	probably benign	Het
Slc19a2	T	A	1: 164,260,876	C298S	probably benign	Het
Son	AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG	AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG	16: 91,660,334		probably benign	Het
St8sia2	T	A	7: 73,960,902	Q211L	possibly damaging	Het
Sult2a2	T	C	7: 13,734,897	I96T	possibly damaging	Het
Tnfaip6	A	G	2: 52,038,216	E14G	probably benign	Het
Trip11	A	T	12: 101,885,198	L869H	probably damaging	Het
Tslp	T	C	18: 32,819,080	Y133H	not run	Het
Ttn	T	C	2: 76,740,990	I26520V	probably damaging	Het
Ttn	A	G	2: 76,932,143	V3374A	unknown	Het
Tubgcp2	T	A	7: 140,007,924	I263F	possibly damaging	Het
Uaca	A	G	9: 60,870,110	E593G	probably damaging	Het
Unc13b	C	T	4: 43,172,235	T1021I	unknown	Het
Ush1c	T	A	7: 46,225,555	I131F	probably benign	Het
Usp24	C	A	4: 106,379,107	D997E	probably benign	Het
Usp54	T	C	14: 20,577,040	T517A	probably benign	Het
Vmn1r151	A	T	7: 22,499,080	M200K	possibly damaging	Het
Vmn2r43	T	C	7: 8,255,329	D295G	probably damaging	Het
Vmn2r70	G	A	7: 85,563,868	P444S	probably damaging	Het
Vmn2r85	G	T	10: 130,418,980	P612T	probably damaging	Het
Vps13d	A	T	4: 145,148,747	V1736D		Het
Zbtb11	A	T	16: 55,990,487	H336L	probably benign	Het

Other mutations in Tab2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00964:Tab2	APN	10	7910073	missense	probably benign	0.21
IGL01316:Tab2	APN	10	7924704	missense	probably damaging	1.00
IGL01902:Tab2	APN	10	7919992	missense	probably benign	0.12
IGL03338:Tab2	APN	10	7919275	missense	probably damaging	1.00
Cosmo	UTSW	10	7924719	missense	probably damaging	1.00
Cosmo-2	UTSW	10	7907481	missense	probably damaging	1.00
R0068:Tab2	UTSW	10	7919677	missense	probably damaging	1.00
R0068:Tab2	UTSW	10	7919677	missense	probably damaging	1.00
R0271:Tab2	UTSW	10	7919158	missense	probably benign
R0458:Tab2	UTSW	10	7919555	missense	probably damaging	1.00
R0608:Tab2	UTSW	10	7920119	missense	probably damaging	0.99
R0632:Tab2	UTSW	10	7919801	missense	probably benign	0.07
R0744:Tab2	UTSW	10	7907581	unclassified	probably benign
R1162:Tab2	UTSW	10	7924719	missense	probably damaging	1.00
R1424:Tab2	UTSW	10	7920048	missense	possibly damaging	0.86
R1954:Tab2	UTSW	10	7919330	missense	probably damaging	1.00
R2516:Tab2	UTSW	10	7907481	missense	probably damaging	1.00
R2518:Tab2	UTSW	10	7907481	missense	probably damaging	1.00
R2520:Tab2	UTSW	10	7907481	missense	probably damaging	1.00
R3418:Tab2	UTSW	10	7907481	missense	probably damaging	1.00
R4081:Tab2	UTSW	10	7919831	missense	probably damaging	1.00
R4177:Tab2	UTSW	10	7919359	missense	probably damaging	1.00
R4178:Tab2	UTSW	10	7919359	missense	probably damaging	1.00
R5410:Tab2	UTSW	10	7919821	missense	possibly damaging	0.86
R5681:Tab2	UTSW	10	7920073	missense	probably damaging	1.00
R5683:Tab2	UTSW	10	7919112	critical splice donor site	probably null
R6857:Tab2	UTSW	10	7920413	missense	possibly damaging	0.50
R7692:Tab2	UTSW	10	7911105	missense	probably damaging	1.00
R7790:Tab2	UTSW	10	7920424	missense	probably damaging	1.00
R7792:Tab2	UTSW	10	7919133	missense	possibly damaging	0.50
Z1088:Tab2	UTSW	10	7920266	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- CATTAGCTCTGTGGGCTGACAC -3'
(R):5'- GGAAGCATGGTCAGTTCAGC -3'

Sequencing Primer
(F):5'- TCTGTGGGCTGACACTCAACAC -3'
(R):5'- GATCAAAGGTCCACCATCA -3'

Posted On

2019-10-07