Incidental Mutation 'R7424:Tab2'
ID575932
Institutional Source Beutler Lab
Gene Symbol Tab2
Ensembl Gene ENSMUSG00000015755
Gene NameTGF-beta activated kinase 1/MAP3K7 binding protein 2
Synonyms1110030N06Rik, Map3k7ip2, A530078N03Rik, Tak1 binding protein 2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7424 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location7905653-7956230 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 7907483 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 678 (H678Q)
Ref Sequence ENSEMBL: ENSMUSP00000121266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000146444] [ENSMUST00000147938]
PDB Structure
Crystal structure of the mouse TAB2-NZF in complex with Lys63-linked di-ubiquitin [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000146444
AA Change: H678Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121266
Gene: ENSMUSG00000015755
AA Change: H678Q

DomainStartEndE-ValueType
CUE 8 50 1.15e-10 SMART
low complexity region 286 311 N/A INTRINSIC
coiled coil region 532 619 N/A INTRINSIC
ZnF_RBZ 666 690 1.91e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147938
SMART Domains Protein: ENSMUSP00000119515
Gene: ENSMUSG00000015755

DomainStartEndE-ValueType
CUE 8 50 1.15e-10 SMART
low complexity region 286 311 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an activator of MAP3K7/TAK1, which is required for for the IL-1 induced activation of nuclear factor kappaB and MAPK8/JNK. This protein forms a kinase complex with TRAF6, MAP3K7 and TAB1, and it thus serves as an adaptor that links MAP3K7 and TRAF6. This protein, along with TAB1 and MAP3K7, also participates in the signal transduction induced by TNFSF11/RANKl through the activation of the receptor activator of NF-kappaB (TNFRSF11A/RANK), which may regulate the development and function of osteoclasts. Studies of the related mouse protein indicate that it functions to protect against liver damage caused by chemical stressors. Mutations in this gene cause congenital heart defects, multiple types, 2 (CHTD2). Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Embryos homozygous for a knock-out allele are viable up to E9.5. Embryos homozygous for a different knock-out allele are normal and viable up to E11.5 but become pale and anemic, exhibit liver hemorrhage and increased apoptosis of hepatoblasts, and die by E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik C T 8: 120,145,545 R71C probably damaging Het
Aanat A T 11: 116,595,629 probably benign Het
Ahrr G T 13: 74,257,545 S91* probably null Het
Ampd1 A T 3: 103,088,442 N223Y probably benign Het
Ankar T G 1: 72,680,058 N544T probably damaging Het
Ankk1 A G 9: 49,418,750 S302P possibly damaging Het
Bcr T C 10: 75,157,100 V809A probably benign Het
Bpifb2 A G 2: 153,890,540 N353S possibly damaging Het
Cyth1 A T 11: 118,184,009 probably null Het
Ddx5 A T 11: 106,782,180 N506K probably benign Het
Dnaja1 A T 4: 40,730,244 I239F probably benign Het
Ethe1 C T 7: 24,606,251 T141I probably damaging Het
Fam160b2 T C 14: 70,594,007 H29R probably damaging Het
Gdap2 A T 3: 100,202,066 I36F unknown Het
Gm13030 A T 4: 138,871,266 D115E unknown Het
Gm13103 C T 4: 143,853,209 P455S probably benign Het
Gm17019 A T 5: 15,029,372 L227Q probably damaging Het
Gm9195 T A 14: 72,435,777 E2517D possibly damaging Het
Gramd2 T A 9: 59,708,071 V39D possibly damaging Het
Hmcn1 C T 1: 150,630,266 W3836* probably null Het
Hspa14 C T 2: 3,489,041 D494N possibly damaging Het
Ifit2 A G 19: 34,573,198 N46S probably benign Het
Ifna6 A T 4: 88,827,807 E131V possibly damaging Het
Ift140 T C 17: 25,037,036 V504A possibly damaging Het
Irgc1 T C 7: 24,432,228 N388S probably damaging Het
Itgal T A 7: 127,317,365 V743E probably benign Het
Itih5 T C 2: 10,245,637 S716P probably damaging Het
Kcnab1 A T 3: 65,266,503 K78N possibly damaging Het
Kif1a A T 1: 93,054,317 V787E possibly damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Krt39 A T 11: 99,518,091 V293E probably damaging Het
Lrrn4 A G 2: 132,869,743 F720S possibly damaging Het
Map2 G A 1: 66,414,824 A958T possibly damaging Het
Map3k9 A G 12: 81,724,097 S906P probably benign Het
Mdc1 T C 17: 35,853,309 S1250P probably benign Het
Meltf G A 16: 31,884,946 V164I probably damaging Het
Mtap T G 4: 89,179,462 probably null Het
Mtus1 C A 8: 41,022,406 V184F probably damaging Het
Myh1 A T 11: 67,213,663 D1015V probably damaging Het
Ndrg1 T C 15: 66,944,938 probably null Het
Nkd1 G T 8: 88,585,175 V130L probably benign Het
Nsfl1c A G 2: 151,500,753 D81G probably benign Het
Nt5c1b T A 12: 10,381,391 probably null Het
Nucb1 T C 7: 45,498,778 K204E possibly damaging Het
Nwd1 T G 8: 72,675,173 M774R possibly damaging Het
Olfr165 A T 16: 19,407,194 V274E probably damaging Het
Olfr262 A T 19: 12,240,954 S236T possibly damaging Het
Olfr654 G C 7: 104,588,700 E299Q probably damaging Het
Pan3 T A 5: 147,536,272 probably null Het
Pcdh15 A T 10: 74,506,485 T1135S probably benign Het
Pfas A G 11: 69,000,092 I331T probably damaging Het
Plxna2 T A 1: 194,806,339 I1641N probably damaging Het
Ptar1 A T 19: 23,718,101 R311W probably damaging Het
Ranbp2 T G 10: 58,479,194 M1912R probably damaging Het
Rbm12 A G 2: 156,097,303 F350L possibly damaging Het
Sdhaf1 T C 7: 30,322,043 D96G probably benign Het
Serpinb6b T A 13: 32,968,667 M53K probably damaging Het
Sh2d6 A T 6: 72,517,164 L147Q probably benign Het
Slc19a2 T A 1: 164,260,876 C298S probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
St8sia2 T A 7: 73,960,902 Q211L possibly damaging Het
Sult2a2 T C 7: 13,734,897 I96T possibly damaging Het
Tnfaip6 A G 2: 52,038,216 E14G probably benign Het
Trip11 A T 12: 101,885,198 L869H probably damaging Het
Tslp T C 18: 32,819,080 Y133H not run Het
Ttn T C 2: 76,740,990 I26520V probably damaging Het
Ttn A G 2: 76,932,143 V3374A unknown Het
Tubgcp2 T A 7: 140,007,924 I263F possibly damaging Het
Uaca A G 9: 60,870,110 E593G probably damaging Het
Unc13b C T 4: 43,172,235 T1021I unknown Het
Ush1c T A 7: 46,225,555 I131F probably benign Het
Usp24 C A 4: 106,379,107 D997E probably benign Het
Usp54 T C 14: 20,577,040 T517A probably benign Het
Vmn1r151 A T 7: 22,499,080 M200K possibly damaging Het
Vmn2r43 T C 7: 8,255,329 D295G probably damaging Het
Vmn2r70 G A 7: 85,563,868 P444S probably damaging Het
Vmn2r85 G T 10: 130,418,980 P612T probably damaging Het
Vps13d A T 4: 145,148,747 V1736D Het
Zbtb11 A T 16: 55,990,487 H336L probably benign Het
Other mutations in Tab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Tab2 APN 10 7910073 missense probably benign 0.21
IGL01316:Tab2 APN 10 7924704 missense probably damaging 1.00
IGL01902:Tab2 APN 10 7919992 missense probably benign 0.12
IGL03338:Tab2 APN 10 7919275 missense probably damaging 1.00
Cosmo UTSW 10 7924719 missense probably damaging 1.00
Cosmo-2 UTSW 10 7907481 missense probably damaging 1.00
R0068:Tab2 UTSW 10 7919677 missense probably damaging 1.00
R0068:Tab2 UTSW 10 7919677 missense probably damaging 1.00
R0271:Tab2 UTSW 10 7919158 missense probably benign
R0458:Tab2 UTSW 10 7919555 missense probably damaging 1.00
R0608:Tab2 UTSW 10 7920119 missense probably damaging 0.99
R0632:Tab2 UTSW 10 7919801 missense probably benign 0.07
R0744:Tab2 UTSW 10 7907581 unclassified probably benign
R1162:Tab2 UTSW 10 7924719 missense probably damaging 1.00
R1424:Tab2 UTSW 10 7920048 missense possibly damaging 0.86
R1954:Tab2 UTSW 10 7919330 missense probably damaging 1.00
R2516:Tab2 UTSW 10 7907481 missense probably damaging 1.00
R2518:Tab2 UTSW 10 7907481 missense probably damaging 1.00
R2520:Tab2 UTSW 10 7907481 missense probably damaging 1.00
R3418:Tab2 UTSW 10 7907481 missense probably damaging 1.00
R4081:Tab2 UTSW 10 7919831 missense probably damaging 1.00
R4177:Tab2 UTSW 10 7919359 missense probably damaging 1.00
R4178:Tab2 UTSW 10 7919359 missense probably damaging 1.00
R5410:Tab2 UTSW 10 7919821 missense possibly damaging 0.86
R5681:Tab2 UTSW 10 7920073 missense probably damaging 1.00
R5683:Tab2 UTSW 10 7919112 critical splice donor site probably null
R6857:Tab2 UTSW 10 7920413 missense possibly damaging 0.50
R7692:Tab2 UTSW 10 7911105 missense probably damaging 1.00
R7790:Tab2 UTSW 10 7920424 missense probably damaging 1.00
R7792:Tab2 UTSW 10 7919133 missense possibly damaging 0.50
Z1088:Tab2 UTSW 10 7920266 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CATTAGCTCTGTGGGCTGACAC -3'
(R):5'- GGAAGCATGGTCAGTTCAGC -3'

Sequencing Primer
(F):5'- TCTGTGGGCTGACACTCAACAC -3'
(R):5'- GATCAAAGGTCCACCATCA -3'
Posted On2019-10-07