Incidental Mutation 'R7424:Trip11'
ID 575944
Institutional Source Beutler Lab
Gene Symbol Trip11
Ensembl Gene ENSMUSG00000021188
Gene Name thyroid hormone receptor interactor 11
Synonyms 3110031G15Rik, TRIP230, 2610511G22Rik, GMAP-210, 6030460N08Rik
MMRRC Submission 045502-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7424 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 101800304-101879463 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 101851457 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 869 (L869H)
Ref Sequence ENSEMBL: ENSMUSP00000021605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021605] [ENSMUST00000176728] [ENSMUST00000177183] [ENSMUST00000177536]
AlphaFold E9Q512
Predicted Effect probably damaging
Transcript: ENSMUST00000021605
AA Change: L869H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021605
Gene: ENSMUSG00000021188
AA Change: L869H

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
coiled coil region 54 130 N/A INTRINSIC
coiled coil region 167 194 N/A INTRINSIC
coiled coil region 218 702 N/A INTRINSIC
coiled coil region 754 990 N/A INTRINSIC
coiled coil region 1022 1051 N/A INTRINSIC
coiled coil region 1196 1261 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
coiled coil region 1336 1481 N/A INTRINSIC
coiled coil region 1547 1657 N/A INTRINSIC
coiled coil region 1681 1771 N/A INTRINSIC
low complexity region 1934 1945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176728
SMART Domains Protein: ENSMUSP00000134992
Gene: ENSMUSG00000021188

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
Pfam:Orthopox_A5L 48 282 6.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177183
AA Change: L584H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134976
Gene: ENSMUSG00000021188
AA Change: L584H

DomainStartEndE-ValueType
coiled coil region 33 158 N/A INTRINSIC
coiled coil region 179 417 N/A INTRINSIC
coiled coil region 469 705 N/A INTRINSIC
coiled coil region 737 766 N/A INTRINSIC
coiled coil region 911 976 N/A INTRINSIC
low complexity region 1025 1037 N/A INTRINSIC
coiled coil region 1051 1196 N/A INTRINSIC
coiled coil region 1262 1372 N/A INTRINSIC
coiled coil region 1396 1486 N/A INTRINSIC
low complexity region 1649 1660 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177480
Predicted Effect probably benign
Transcript: ENSMUST00000177536
SMART Domains Protein: ENSMUSP00000135669
Gene: ENSMUSG00000021188

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
coiled coil region 53 129 N/A INTRINSIC
coiled coil region 166 193 N/A INTRINSIC
coiled coil region 217 517 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on the interaction of its protein product with thyroid hormone receptor beta. This protein is associated with the Golgi apparatus. The N-terminal region of the protein binds Golgi membranes and the C-terminal region binds the minus ends of microtubules; thus, the protein is thought to play a role in assembly and maintenance of the Golgi ribbon structure around the centrosome. Mutations in this gene cause achondrogenesis type IA.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with small size, lung hypoplasia, omphalocele, and ventricular septal defects. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Gene trapped(11) Chemically induced(1)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik C T 8: 120,872,284 (GRCm39) R71C probably damaging Het
Aanat A T 11: 116,486,455 (GRCm39) probably benign Het
Ahrr G T 13: 74,405,664 (GRCm39) S91* probably null Het
Ampd1 A T 3: 102,995,758 (GRCm39) N223Y probably benign Het
Ankar T G 1: 72,719,217 (GRCm39) N544T probably damaging Het
Ankk1 A G 9: 49,330,050 (GRCm39) S302P possibly damaging Het
Bcr T C 10: 74,992,932 (GRCm39) V809A probably benign Het
Bpifb2 A G 2: 153,732,460 (GRCm39) N353S possibly damaging Het
Cyth1 A T 11: 118,074,835 (GRCm39) probably null Het
Ddx5 A T 11: 106,673,006 (GRCm39) N506K probably benign Het
Dnaja1 A T 4: 40,730,244 (GRCm39) I239F probably benign Het
Ethe1 C T 7: 24,305,676 (GRCm39) T141I probably damaging Het
Fhip2b T C 14: 70,831,447 (GRCm39) H29R probably damaging Het
Gdap2 A T 3: 100,109,382 (GRCm39) I36F unknown Het
Gm13030 A T 4: 138,598,577 (GRCm39) D115E unknown Het
Gm17019 A T 5: 15,079,386 (GRCm39) L227Q probably damaging Het
Gm9195 T A 14: 72,673,217 (GRCm39) E2517D possibly damaging Het
Gramd2a T A 9: 59,615,354 (GRCm39) V39D possibly damaging Het
Hmcn1 C T 1: 150,506,017 (GRCm39) W3836* probably null Het
Hspa14 C T 2: 3,490,078 (GRCm39) D494N possibly damaging Het
Ifit2 A G 19: 34,550,598 (GRCm39) N46S probably benign Het
Ifna6 A T 4: 88,746,044 (GRCm39) E131V possibly damaging Het
Ift140 T C 17: 25,256,010 (GRCm39) V504A possibly damaging Het
Irgc T C 7: 24,131,653 (GRCm39) N388S probably damaging Het
Itgal T A 7: 126,916,537 (GRCm39) V743E probably benign Het
Itih5 T C 2: 10,250,448 (GRCm39) S716P probably damaging Het
Kcnab1 A T 3: 65,173,924 (GRCm39) K78N possibly damaging Het
Kif1a A T 1: 92,982,039 (GRCm39) V787E possibly damaging Het
Krt15 A T 11: 100,026,386 (GRCm39) V100E possibly damaging Het
Krt39 A T 11: 99,408,917 (GRCm39) V293E probably damaging Het
Lrrn4 A G 2: 132,711,663 (GRCm39) F720S possibly damaging Het
Map2 G A 1: 66,453,983 (GRCm39) A958T possibly damaging Het
Map3k9 A G 12: 81,770,871 (GRCm39) S906P probably benign Het
Mdc1 T C 17: 36,164,201 (GRCm39) S1250P probably benign Het
Meltf G A 16: 31,703,764 (GRCm39) V164I probably damaging Het
Mtap T G 4: 89,097,699 (GRCm39) probably null Het
Mtus1 C A 8: 41,475,443 (GRCm39) V184F probably damaging Het
Myh1 A T 11: 67,104,489 (GRCm39) D1015V probably damaging Het
Ndrg1 T C 15: 66,816,787 (GRCm39) probably null Het
Nkd1 G T 8: 89,311,803 (GRCm39) V130L probably benign Het
Nsfl1c A G 2: 151,342,673 (GRCm39) D81G probably benign Het
Nt5c1b T A 12: 10,431,391 (GRCm39) probably null Het
Nucb1 T C 7: 45,148,202 (GRCm39) K204E possibly damaging Het
Nwd1 T G 8: 73,401,801 (GRCm39) M774R possibly damaging Het
Or2m13 A T 16: 19,225,944 (GRCm39) V274E probably damaging Het
Or52u1 G C 7: 104,237,907 (GRCm39) E299Q probably damaging Het
Or5an1c A T 19: 12,218,318 (GRCm39) S236T possibly damaging Het
Pan3 T A 5: 147,473,082 (GRCm39) probably null Het
Pcdh15 A T 10: 74,342,317 (GRCm39) T1135S probably benign Het
Pfas A G 11: 68,890,918 (GRCm39) I331T probably damaging Het
Plxna2 T A 1: 194,488,647 (GRCm39) I1641N probably damaging Het
Pramel27 C T 4: 143,579,779 (GRCm39) P455S probably benign Het
Ptar1 A T 19: 23,695,465 (GRCm39) R311W probably damaging Het
Ranbp2 T G 10: 58,315,016 (GRCm39) M1912R probably damaging Het
Rbm12 A G 2: 155,939,223 (GRCm39) F350L possibly damaging Het
Sdhaf1 T C 7: 30,021,468 (GRCm39) D96G probably benign Het
Serpinb6b T A 13: 33,152,650 (GRCm39) M53K probably damaging Het
Sh2d6 A T 6: 72,494,147 (GRCm39) L147Q probably benign Het
Slc19a2 T A 1: 164,088,445 (GRCm39) C298S probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,457,222 (GRCm39) probably benign Het
St8sia2 T A 7: 73,610,650 (GRCm39) Q211L possibly damaging Het
Sult2a2 T C 7: 13,468,822 (GRCm39) I96T possibly damaging Het
Tab2 G T 10: 7,783,247 (GRCm39) H678Q probably damaging Het
Tnfaip6 A G 2: 51,928,228 (GRCm39) E14G probably benign Het
Tslp T C 18: 32,952,133 (GRCm39) Y133H not run Het
Ttn A G 2: 76,762,487 (GRCm39) V3374A unknown Het
Ttn T C 2: 76,571,334 (GRCm39) I26520V probably damaging Het
Tubgcp2 T A 7: 139,587,837 (GRCm39) I263F possibly damaging Het
Uaca A G 9: 60,777,392 (GRCm39) E593G probably damaging Het
Unc13b C T 4: 43,172,235 (GRCm39) T1021I unknown Het
Ush1c T A 7: 45,874,979 (GRCm39) I131F probably benign Het
Usp24 C A 4: 106,236,304 (GRCm39) D997E probably benign Het
Usp54 T C 14: 20,627,108 (GRCm39) T517A probably benign Het
Vmn1r151 A T 7: 22,198,505 (GRCm39) M200K possibly damaging Het
Vmn2r43 T C 7: 8,258,328 (GRCm39) D295G probably damaging Het
Vmn2r70 G A 7: 85,213,076 (GRCm39) P444S probably damaging Het
Vmn2r85 G T 10: 130,254,849 (GRCm39) P612T probably damaging Het
Vps13d A T 4: 144,875,317 (GRCm39) V1736D Het
Zbtb11 A T 16: 55,810,850 (GRCm39) H336L probably benign Het
Other mutations in Trip11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Trip11 APN 12 101,852,406 (GRCm39) missense probably benign 0.37
IGL00484:Trip11 APN 12 101,851,570 (GRCm39) nonsense probably null
IGL00972:Trip11 APN 12 101,860,596 (GRCm39) missense probably null 1.00
IGL01476:Trip11 APN 12 101,865,170 (GRCm39) missense probably damaging 0.96
IGL01591:Trip11 APN 12 101,849,604 (GRCm39) missense probably damaging 0.98
IGL01667:Trip11 APN 12 101,845,121 (GRCm39) missense probably damaging 1.00
IGL01764:Trip11 APN 12 101,850,890 (GRCm39) missense probably damaging 1.00
IGL01789:Trip11 APN 12 101,838,090 (GRCm39) missense probably benign 0.05
IGL01814:Trip11 APN 12 101,850,747 (GRCm39) missense probably damaging 0.98
IGL01898:Trip11 APN 12 101,851,935 (GRCm39) missense probably benign
IGL01924:Trip11 APN 12 101,853,143 (GRCm39) missense possibly damaging 0.93
IGL02020:Trip11 APN 12 101,850,572 (GRCm39) missense probably damaging 1.00
IGL02475:Trip11 APN 12 101,861,942 (GRCm39) missense probably benign 0.01
IGL02544:Trip11 APN 12 101,859,780 (GRCm39) missense probably damaging 1.00
IGL02678:Trip11 APN 12 101,849,649 (GRCm39) missense probably damaging 0.96
IGL02714:Trip11 APN 12 101,850,260 (GRCm39) missense probably damaging 1.00
IGL02718:Trip11 APN 12 101,852,284 (GRCm39) missense probably benign 0.24
IGL02904:Trip11 APN 12 101,853,097 (GRCm39) missense probably damaging 1.00
IGL03012:Trip11 APN 12 101,850,195 (GRCm39) missense probably damaging 1.00
IGL03191:Trip11 APN 12 101,865,184 (GRCm39) missense probably damaging 1.00
IGL03327:Trip11 APN 12 101,849,677 (GRCm39) missense possibly damaging 0.87
IGL03337:Trip11 APN 12 101,851,278 (GRCm39) missense probably damaging 1.00
NA:Trip11 UTSW 12 101,860,580 (GRCm39) splice site probably null
R0027:Trip11 UTSW 12 101,851,428 (GRCm39) missense probably benign 0.00
R0028:Trip11 UTSW 12 101,851,016 (GRCm39) missense probably damaging 1.00
R0238:Trip11 UTSW 12 101,850,987 (GRCm39) missense probably damaging 1.00
R0238:Trip11 UTSW 12 101,850,987 (GRCm39) missense probably damaging 1.00
R0239:Trip11 UTSW 12 101,850,987 (GRCm39) missense probably damaging 1.00
R0239:Trip11 UTSW 12 101,850,987 (GRCm39) missense probably damaging 1.00
R0505:Trip11 UTSW 12 101,851,931 (GRCm39) missense probably damaging 0.98
R0556:Trip11 UTSW 12 101,850,777 (GRCm39) nonsense probably null
R0573:Trip11 UTSW 12 101,853,119 (GRCm39) missense probably benign 0.02
R0626:Trip11 UTSW 12 101,852,235 (GRCm39) missense possibly damaging 0.54
R1519:Trip11 UTSW 12 101,852,419 (GRCm39) missense probably benign 0.04
R1530:Trip11 UTSW 12 101,879,026 (GRCm39) missense unknown
R1647:Trip11 UTSW 12 101,850,651 (GRCm39) nonsense probably null
R1648:Trip11 UTSW 12 101,850,651 (GRCm39) nonsense probably null
R1856:Trip11 UTSW 12 101,849,592 (GRCm39) nonsense probably null
R2013:Trip11 UTSW 12 101,803,981 (GRCm39) missense probably damaging 1.00
R2017:Trip11 UTSW 12 101,851,619 (GRCm39) missense probably benign 0.00
R2206:Trip11 UTSW 12 101,839,701 (GRCm39) missense probably benign 0.25
R2207:Trip11 UTSW 12 101,839,701 (GRCm39) missense probably benign 0.25
R2304:Trip11 UTSW 12 101,865,236 (GRCm39) missense possibly damaging 0.58
R2328:Trip11 UTSW 12 101,845,086 (GRCm39) makesense probably null
R2513:Trip11 UTSW 12 101,803,986 (GRCm39) missense possibly damaging 0.94
R3499:Trip11 UTSW 12 101,859,953 (GRCm39) missense possibly damaging 0.87
R4105:Trip11 UTSW 12 101,860,581 (GRCm39) nonsense probably null
R4124:Trip11 UTSW 12 101,861,957 (GRCm39) nonsense probably null
R4126:Trip11 UTSW 12 101,861,957 (GRCm39) nonsense probably null
R4128:Trip11 UTSW 12 101,861,957 (GRCm39) nonsense probably null
R4175:Trip11 UTSW 12 101,861,957 (GRCm39) nonsense probably null
R4176:Trip11 UTSW 12 101,861,957 (GRCm39) nonsense probably null
R4181:Trip11 UTSW 12 101,860,027 (GRCm39) missense probably damaging 1.00
R4296:Trip11 UTSW 12 101,852,127 (GRCm39) nonsense probably null
R4302:Trip11 UTSW 12 101,860,027 (GRCm39) missense probably damaging 1.00
R4306:Trip11 UTSW 12 101,853,198 (GRCm39) missense probably benign
R4342:Trip11 UTSW 12 101,850,575 (GRCm39) missense probably damaging 1.00
R4576:Trip11 UTSW 12 101,852,499 (GRCm39) nonsense probably null
R4586:Trip11 UTSW 12 101,849,600 (GRCm39) missense possibly damaging 0.55
R4634:Trip11 UTSW 12 101,803,875 (GRCm39) missense probably damaging 1.00
R4696:Trip11 UTSW 12 101,851,549 (GRCm39) missense possibly damaging 0.71
R4792:Trip11 UTSW 12 101,851,705 (GRCm39) missense probably benign 0.10
R4903:Trip11 UTSW 12 101,853,065 (GRCm39) critical splice donor site probably null
R5001:Trip11 UTSW 12 101,851,169 (GRCm39) nonsense probably null
R5017:Trip11 UTSW 12 101,812,879 (GRCm39) missense probably benign 0.00
R5227:Trip11 UTSW 12 101,851,179 (GRCm39) missense probably damaging 1.00
R5231:Trip11 UTSW 12 101,851,860 (GRCm39) missense probably damaging 0.96
R5539:Trip11 UTSW 12 101,851,386 (GRCm39) missense probably damaging 0.98
R5754:Trip11 UTSW 12 101,851,924 (GRCm39) nonsense probably null
R5755:Trip11 UTSW 12 101,851,924 (GRCm39) nonsense probably null
R5890:Trip11 UTSW 12 101,852,231 (GRCm39) missense probably damaging 0.99
R5910:Trip11 UTSW 12 101,849,738 (GRCm39) missense probably damaging 1.00
R6083:Trip11 UTSW 12 101,856,001 (GRCm39) missense probably benign 0.00
R6208:Trip11 UTSW 12 101,865,154 (GRCm39) missense probably damaging 1.00
R6216:Trip11 UTSW 12 101,856,859 (GRCm39) missense probably benign 0.31
R6315:Trip11 UTSW 12 101,851,837 (GRCm39) missense possibly damaging 0.84
R6413:Trip11 UTSW 12 101,851,790 (GRCm39) missense probably benign 0.12
R6590:Trip11 UTSW 12 101,851,710 (GRCm39) missense possibly damaging 0.92
R6690:Trip11 UTSW 12 101,851,710 (GRCm39) missense possibly damaging 0.92
R6914:Trip11 UTSW 12 101,812,879 (GRCm39) missense probably benign 0.00
R6938:Trip11 UTSW 12 101,803,886 (GRCm39) missense probably damaging 0.98
R7015:Trip11 UTSW 12 101,859,942 (GRCm39) missense probably damaging 1.00
R7023:Trip11 UTSW 12 101,852,126 (GRCm39) missense probably benign 0.13
R7133:Trip11 UTSW 12 101,850,329 (GRCm39) missense probably damaging 0.97
R7271:Trip11 UTSW 12 101,850,611 (GRCm39) missense probably damaging 1.00
R7431:Trip11 UTSW 12 101,850,278 (GRCm39) missense possibly damaging 0.84
R7472:Trip11 UTSW 12 101,851,639 (GRCm39) missense probably benign 0.00
R7491:Trip11 UTSW 12 101,851,694 (GRCm39) missense probably damaging 1.00
R7752:Trip11 UTSW 12 101,853,233 (GRCm39) missense probably benign 0.01
R7763:Trip11 UTSW 12 101,811,114 (GRCm39) missense probably benign 0.03
R7779:Trip11 UTSW 12 101,849,796 (GRCm39) missense probably damaging 0.97
R7844:Trip11 UTSW 12 101,844,403 (GRCm39) missense probably damaging 1.00
R8055:Trip11 UTSW 12 101,803,924 (GRCm39) missense probably damaging 1.00
R8076:Trip11 UTSW 12 101,849,741 (GRCm39) missense probably damaging 1.00
R8288:Trip11 UTSW 12 101,860,643 (GRCm39) missense possibly damaging 0.73
R8294:Trip11 UTSW 12 101,811,160 (GRCm39) missense possibly damaging 0.93
R8318:Trip11 UTSW 12 101,879,063 (GRCm39) missense unknown
R8690:Trip11 UTSW 12 101,839,656 (GRCm39) missense possibly damaging 0.76
R8879:Trip11 UTSW 12 101,828,857 (GRCm39) missense probably benign 0.00
R8964:Trip11 UTSW 12 101,811,315 (GRCm39) critical splice donor site probably null
R9005:Trip11 UTSW 12 101,845,131 (GRCm39) missense probably benign 0.02
R9013:Trip11 UTSW 12 101,851,377 (GRCm39) missense probably damaging 0.99
R9020:Trip11 UTSW 12 101,850,770 (GRCm39) missense possibly damaging 0.91
R9041:Trip11 UTSW 12 101,845,127 (GRCm39) missense probably benign 0.06
R9234:Trip11 UTSW 12 101,811,990 (GRCm39) critical splice donor site probably null
R9447:Trip11 UTSW 12 101,850,148 (GRCm39) missense probably damaging 1.00
R9631:Trip11 UTSW 12 101,859,807 (GRCm39) missense probably benign
R9641:Trip11 UTSW 12 101,859,957 (GRCm39) nonsense probably null
R9691:Trip11 UTSW 12 101,850,123 (GRCm39) missense probably benign 0.00
R9751:Trip11 UTSW 12 101,850,765 (GRCm39) missense possibly damaging 0.54
X0020:Trip11 UTSW 12 101,852,172 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGTAGAGACTGGAGTAGCTGC -3'
(R):5'- TGGATACTGATCATAAACGAACCAAGG -3'

Sequencing Primer
(F):5'- GCTGCAGCTTGCTCTGG -3'
(R):5'- GACTTTGTCATCTAGTTTAGAAGAGC -3'
Posted On 2019-10-07