Incidental Mutation 'R7424:Zbtb11'
ID 575952
Institutional Source Beutler Lab
Gene Symbol Zbtb11
Ensembl Gene ENSMUSG00000022601
Gene Name zinc finger and BTB domain containing 11
Synonyms 9230110G02Rik, ZNF-U69274
MMRRC Submission 045502-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.971) question?
Stock # R7424 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 55794246-55829276 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 55810850 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 336 (H336L)
Ref Sequence ENSEMBL: ENSMUSP00000056923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050248]
AlphaFold G5E8B9
Predicted Effect probably benign
Transcript: ENSMUST00000050248
AA Change: H336L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000056923
Gene: ENSMUSG00000022601
AA Change: H336L

DomainStartEndE-ValueType
low complexity region 136 158 N/A INTRINSIC
low complexity region 161 177 N/A INTRINSIC
BTB 214 312 4.77e-13 SMART
low complexity region 371 399 N/A INTRINSIC
ZnF_C2H2 566 588 1.1e-2 SMART
ZnF_C2H2 594 616 2.09e-3 SMART
low complexity region 623 640 N/A INTRINSIC
ZnF_C2H2 648 670 4.47e-3 SMART
ZnF_C2H2 676 698 8.22e-2 SMART
ZnF_C2H2 704 726 2.27e-4 SMART
ZnF_C2H2 732 754 1.28e-3 SMART
ZnF_C2H2 763 785 2.95e-3 SMART
ZnF_C2H2 791 813 7.67e-2 SMART
ZnF_C2H2 819 843 2.95e-3 SMART
ZnF_C2H2 855 877 1.67e-2 SMART
ZnF_C2H2 883 905 3.02e0 SMART
ZnF_C2H2 911 934 9.58e-3 SMART
low complexity region 979 994 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (76/77)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik C T 8: 120,872,284 (GRCm39) R71C probably damaging Het
Aanat A T 11: 116,486,455 (GRCm39) probably benign Het
Ahrr G T 13: 74,405,664 (GRCm39) S91* probably null Het
Ampd1 A T 3: 102,995,758 (GRCm39) N223Y probably benign Het
Ankar T G 1: 72,719,217 (GRCm39) N544T probably damaging Het
Ankk1 A G 9: 49,330,050 (GRCm39) S302P possibly damaging Het
Bcr T C 10: 74,992,932 (GRCm39) V809A probably benign Het
Bpifb2 A G 2: 153,732,460 (GRCm39) N353S possibly damaging Het
Cyth1 A T 11: 118,074,835 (GRCm39) probably null Het
Ddx5 A T 11: 106,673,006 (GRCm39) N506K probably benign Het
Dnaja1 A T 4: 40,730,244 (GRCm39) I239F probably benign Het
Ethe1 C T 7: 24,305,676 (GRCm39) T141I probably damaging Het
Fhip2b T C 14: 70,831,447 (GRCm39) H29R probably damaging Het
Gdap2 A T 3: 100,109,382 (GRCm39) I36F unknown Het
Gm13030 A T 4: 138,598,577 (GRCm39) D115E unknown Het
Gm17019 A T 5: 15,079,386 (GRCm39) L227Q probably damaging Het
Gm9195 T A 14: 72,673,217 (GRCm39) E2517D possibly damaging Het
Gramd2a T A 9: 59,615,354 (GRCm39) V39D possibly damaging Het
Hmcn1 C T 1: 150,506,017 (GRCm39) W3836* probably null Het
Hspa14 C T 2: 3,490,078 (GRCm39) D494N possibly damaging Het
Ifit2 A G 19: 34,550,598 (GRCm39) N46S probably benign Het
Ifna6 A T 4: 88,746,044 (GRCm39) E131V possibly damaging Het
Ift140 T C 17: 25,256,010 (GRCm39) V504A possibly damaging Het
Irgc T C 7: 24,131,653 (GRCm39) N388S probably damaging Het
Itgal T A 7: 126,916,537 (GRCm39) V743E probably benign Het
Itih5 T C 2: 10,250,448 (GRCm39) S716P probably damaging Het
Kcnab1 A T 3: 65,173,924 (GRCm39) K78N possibly damaging Het
Kif1a A T 1: 92,982,039 (GRCm39) V787E possibly damaging Het
Krt15 A T 11: 100,026,386 (GRCm39) V100E possibly damaging Het
Krt39 A T 11: 99,408,917 (GRCm39) V293E probably damaging Het
Lrrn4 A G 2: 132,711,663 (GRCm39) F720S possibly damaging Het
Map2 G A 1: 66,453,983 (GRCm39) A958T possibly damaging Het
Map3k9 A G 12: 81,770,871 (GRCm39) S906P probably benign Het
Mdc1 T C 17: 36,164,201 (GRCm39) S1250P probably benign Het
Meltf G A 16: 31,703,764 (GRCm39) V164I probably damaging Het
Mtap T G 4: 89,097,699 (GRCm39) probably null Het
Mtus1 C A 8: 41,475,443 (GRCm39) V184F probably damaging Het
Myh1 A T 11: 67,104,489 (GRCm39) D1015V probably damaging Het
Ndrg1 T C 15: 66,816,787 (GRCm39) probably null Het
Nkd1 G T 8: 89,311,803 (GRCm39) V130L probably benign Het
Nsfl1c A G 2: 151,342,673 (GRCm39) D81G probably benign Het
Nt5c1b T A 12: 10,431,391 (GRCm39) probably null Het
Nucb1 T C 7: 45,148,202 (GRCm39) K204E possibly damaging Het
Nwd1 T G 8: 73,401,801 (GRCm39) M774R possibly damaging Het
Or2m13 A T 16: 19,225,944 (GRCm39) V274E probably damaging Het
Or52u1 G C 7: 104,237,907 (GRCm39) E299Q probably damaging Het
Or5an1c A T 19: 12,218,318 (GRCm39) S236T possibly damaging Het
Pan3 T A 5: 147,473,082 (GRCm39) probably null Het
Pcdh15 A T 10: 74,342,317 (GRCm39) T1135S probably benign Het
Pfas A G 11: 68,890,918 (GRCm39) I331T probably damaging Het
Plxna2 T A 1: 194,488,647 (GRCm39) I1641N probably damaging Het
Pramel27 C T 4: 143,579,779 (GRCm39) P455S probably benign Het
Ptar1 A T 19: 23,695,465 (GRCm39) R311W probably damaging Het
Ranbp2 T G 10: 58,315,016 (GRCm39) M1912R probably damaging Het
Rbm12 A G 2: 155,939,223 (GRCm39) F350L possibly damaging Het
Sdhaf1 T C 7: 30,021,468 (GRCm39) D96G probably benign Het
Serpinb6b T A 13: 33,152,650 (GRCm39) M53K probably damaging Het
Sh2d6 A T 6: 72,494,147 (GRCm39) L147Q probably benign Het
Slc19a2 T A 1: 164,088,445 (GRCm39) C298S probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,457,222 (GRCm39) probably benign Het
St8sia2 T A 7: 73,610,650 (GRCm39) Q211L possibly damaging Het
Sult2a2 T C 7: 13,468,822 (GRCm39) I96T possibly damaging Het
Tab2 G T 10: 7,783,247 (GRCm39) H678Q probably damaging Het
Tnfaip6 A G 2: 51,928,228 (GRCm39) E14G probably benign Het
Trip11 A T 12: 101,851,457 (GRCm39) L869H probably damaging Het
Tslp T C 18: 32,952,133 (GRCm39) Y133H not run Het
Ttn A G 2: 76,762,487 (GRCm39) V3374A unknown Het
Ttn T C 2: 76,571,334 (GRCm39) I26520V probably damaging Het
Tubgcp2 T A 7: 139,587,837 (GRCm39) I263F possibly damaging Het
Uaca A G 9: 60,777,392 (GRCm39) E593G probably damaging Het
Unc13b C T 4: 43,172,235 (GRCm39) T1021I unknown Het
Ush1c T A 7: 45,874,979 (GRCm39) I131F probably benign Het
Usp24 C A 4: 106,236,304 (GRCm39) D997E probably benign Het
Usp54 T C 14: 20,627,108 (GRCm39) T517A probably benign Het
Vmn1r151 A T 7: 22,198,505 (GRCm39) M200K possibly damaging Het
Vmn2r43 T C 7: 8,258,328 (GRCm39) D295G probably damaging Het
Vmn2r70 G A 7: 85,213,076 (GRCm39) P444S probably damaging Het
Vmn2r85 G T 10: 130,254,849 (GRCm39) P612T probably damaging Het
Vps13d A T 4: 144,875,317 (GRCm39) V1736D Het
Other mutations in Zbtb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Zbtb11 APN 16 55,820,965 (GRCm39) nonsense probably null
IGL01107:Zbtb11 APN 16 55,826,370 (GRCm39) missense probably damaging 1.00
IGL01341:Zbtb11 APN 16 55,811,294 (GRCm39) missense possibly damaging 0.68
IGL01510:Zbtb11 APN 16 55,810,706 (GRCm39) missense probably damaging 0.99
IGL01611:Zbtb11 APN 16 55,800,973 (GRCm39) missense probably damaging 1.00
IGL01736:Zbtb11 APN 16 55,818,523 (GRCm39) missense probably damaging 1.00
IGL01834:Zbtb11 APN 16 55,811,371 (GRCm39) missense probably benign 0.35
IGL02427:Zbtb11 APN 16 55,802,713 (GRCm39) missense possibly damaging 0.95
IGL02441:Zbtb11 APN 16 55,794,552 (GRCm39) missense possibly damaging 0.94
IGL02455:Zbtb11 APN 16 55,821,038 (GRCm39) missense probably damaging 1.00
PIT4544001:Zbtb11 UTSW 16 55,818,556 (GRCm39) nonsense probably null
R0987:Zbtb11 UTSW 16 55,811,071 (GRCm39) missense probably benign 0.00
R1414:Zbtb11 UTSW 16 55,810,923 (GRCm39) nonsense probably null
R1437:Zbtb11 UTSW 16 55,811,983 (GRCm39) critical splice donor site probably null
R1570:Zbtb11 UTSW 16 55,811,178 (GRCm39) missense probably benign
R1658:Zbtb11 UTSW 16 55,794,588 (GRCm39) missense possibly damaging 0.71
R1735:Zbtb11 UTSW 16 55,811,045 (GRCm39) missense probably benign
R2048:Zbtb11 UTSW 16 55,818,372 (GRCm39) missense probably damaging 1.00
R2925:Zbtb11 UTSW 16 55,794,447 (GRCm39) missense probably benign 0.00
R4072:Zbtb11 UTSW 16 55,818,427 (GRCm39) missense possibly damaging 0.89
R4075:Zbtb11 UTSW 16 55,818,427 (GRCm39) missense possibly damaging 0.89
R4076:Zbtb11 UTSW 16 55,818,427 (GRCm39) missense possibly damaging 0.89
R5023:Zbtb11 UTSW 16 55,826,428 (GRCm39) missense probably damaging 1.00
R5755:Zbtb11 UTSW 16 55,821,076 (GRCm39) missense probably benign 0.02
R5757:Zbtb11 UTSW 16 55,827,392 (GRCm39) missense probably damaging 1.00
R6218:Zbtb11 UTSW 16 55,818,436 (GRCm39) missense probably benign 0.00
R6313:Zbtb11 UTSW 16 55,810,854 (GRCm39) missense probably benign 0.03
R6461:Zbtb11 UTSW 16 55,827,234 (GRCm39) missense probably damaging 0.99
R6666:Zbtb11 UTSW 16 55,826,615 (GRCm39) missense probably damaging 1.00
R6807:Zbtb11 UTSW 16 55,810,865 (GRCm39) missense probably benign 0.03
R7194:Zbtb11 UTSW 16 55,827,551 (GRCm39) missense probably damaging 1.00
R8022:Zbtb11 UTSW 16 55,826,383 (GRCm39) missense probably damaging 0.99
R8436:Zbtb11 UTSW 16 55,821,022 (GRCm39) nonsense probably null
R8532:Zbtb11 UTSW 16 55,811,252 (GRCm39) missense probably benign 0.03
R8806:Zbtb11 UTSW 16 55,802,637 (GRCm39) missense probably damaging 1.00
R9033:Zbtb11 UTSW 16 55,818,492 (GRCm39) missense probably benign
R9673:Zbtb11 UTSW 16 55,827,336 (GRCm39) missense probably damaging 1.00
RF014:Zbtb11 UTSW 16 55,800,960 (GRCm39) missense probably damaging 0.97
Z1176:Zbtb11 UTSW 16 55,811,865 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTGTAAAGCAAGCTTCCTTCC -3'
(R):5'- ACACACTAGCTTCAGCCTCTG -3'

Sequencing Primer
(F):5'- GCTGGAATTTGCCTATACTTCTG -3'
(R):5'- TTCAGCCTCTGGAGAAGCCTG -3'
Posted On 2019-10-07