Incidental Mutation 'R7424:Mdc1'
ID575955
Institutional Source Beutler Lab
Gene Symbol Mdc1
Ensembl Gene ENSMUSG00000061607
Gene Namemediator of DNA damage checkpoint 1
SynonymsNFBD1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R7424 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location35841515-35859670 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35853309 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1250 (S1250P)
Ref Sequence ENSEMBL: ENSMUSP00000080949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082337]
Predicted Effect probably benign
Transcript: ENSMUST00000082337
AA Change: S1250P

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000080949
Gene: ENSMUSG00000061607
AA Change: S1250P

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
FHA 53 105 5.63e-9 SMART
low complexity region 194 215 N/A INTRINSIC
low complexity region 854 870 N/A INTRINSIC
low complexity region 969 987 N/A INTRINSIC
low complexity region 1008 1022 N/A INTRINSIC
internal_repeat_1 1027 1115 6.7e-11 PROSPERO
internal_repeat_2 1030 1141 2.36e-9 PROSPERO
internal_repeat_1 1266 1354 6.7e-11 PROSPERO
internal_repeat_2 1298 1417 2.36e-9 PROSPERO
low complexity region 1422 1445 N/A INTRINSIC
low complexity region 1457 1477 N/A INTRINSIC
BRCT 1502 1579 1.66e-1 SMART
BRCT 1612 1691 2.45e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000225192
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: The protein encoded by this gene contains an N-terminal forkhead domain, two BRCA1 C-terminal (BRCT) motifs and a central domain with 7 divergent copies of an approximately 41-amino acid sequence. The encoded protein is required to activate the intra-S phase and G2/M phase cell cycle checkpoints in response to DNA damage. This nuclear protein interacts with phosphorylated histone H2AX near sites of DNA double-strand breaks through its BRCT motifs, and facilitates recruitment of the ATM kinase and meiotic recombination 11 protein complex to DNA damage foci. Mice with mutations in this gene exhibit growth retardation, male infertility, immune defects, chromosome instability, DNA repair defects, and radiation sensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are smaller and display increased susceptibility to ionizing radiation, male infertility, T and B cell abnormalities, and increased genomic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik C T 8: 120,145,545 R71C probably damaging Het
Aanat A T 11: 116,595,629 probably benign Het
Ahrr G T 13: 74,257,545 S91* probably null Het
Ampd1 A T 3: 103,088,442 N223Y probably benign Het
Ankar T G 1: 72,680,058 N544T probably damaging Het
Ankk1 A G 9: 49,418,750 S302P possibly damaging Het
Bcr T C 10: 75,157,100 V809A probably benign Het
Bpifb2 A G 2: 153,890,540 N353S possibly damaging Het
Cyth1 A T 11: 118,184,009 probably null Het
Ddx5 A T 11: 106,782,180 N506K probably benign Het
Dnaja1 A T 4: 40,730,244 I239F probably benign Het
Ethe1 C T 7: 24,606,251 T141I probably damaging Het
Fam160b2 T C 14: 70,594,007 H29R probably damaging Het
Gdap2 A T 3: 100,202,066 I36F unknown Het
Gm13030 A T 4: 138,871,266 D115E unknown Het
Gm13103 C T 4: 143,853,209 P455S probably benign Het
Gm17019 A T 5: 15,029,372 L227Q probably damaging Het
Gm9195 T A 14: 72,435,777 E2517D possibly damaging Het
Gramd2 T A 9: 59,708,071 V39D possibly damaging Het
Hmcn1 C T 1: 150,630,266 W3836* probably null Het
Hspa14 C T 2: 3,489,041 D494N possibly damaging Het
Ifit2 A G 19: 34,573,198 N46S probably benign Het
Ifna6 A T 4: 88,827,807 E131V possibly damaging Het
Ift140 T C 17: 25,037,036 V504A possibly damaging Het
Irgc1 T C 7: 24,432,228 N388S probably damaging Het
Itgal T A 7: 127,317,365 V743E probably benign Het
Itih5 T C 2: 10,245,637 S716P probably damaging Het
Kcnab1 A T 3: 65,266,503 K78N possibly damaging Het
Kif1a A T 1: 93,054,317 V787E possibly damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Krt39 A T 11: 99,518,091 V293E probably damaging Het
Lrrn4 A G 2: 132,869,743 F720S possibly damaging Het
Map2 G A 1: 66,414,824 A958T possibly damaging Het
Map3k9 A G 12: 81,724,097 S906P probably benign Het
Meltf G A 16: 31,884,946 V164I probably damaging Het
Mtap T G 4: 89,179,462 probably null Het
Mtus1 C A 8: 41,022,406 V184F probably damaging Het
Myh1 A T 11: 67,213,663 D1015V probably damaging Het
Ndrg1 T C 15: 66,944,938 probably null Het
Nkd1 G T 8: 88,585,175 V130L probably benign Het
Nsfl1c A G 2: 151,500,753 D81G probably benign Het
Nt5c1b T A 12: 10,381,391 probably null Het
Nucb1 T C 7: 45,498,778 K204E possibly damaging Het
Nwd1 T G 8: 72,675,173 M774R possibly damaging Het
Olfr165 A T 16: 19,407,194 V274E probably damaging Het
Olfr262 A T 19: 12,240,954 S236T possibly damaging Het
Olfr654 G C 7: 104,588,700 E299Q probably damaging Het
Pan3 T A 5: 147,536,272 probably null Het
Pcdh15 A T 10: 74,506,485 T1135S probably benign Het
Pfas A G 11: 69,000,092 I331T probably damaging Het
Plxna2 T A 1: 194,806,339 I1641N probably damaging Het
Ptar1 A T 19: 23,718,101 R311W probably damaging Het
Ranbp2 T G 10: 58,479,194 M1912R probably damaging Het
Rbm12 A G 2: 156,097,303 F350L possibly damaging Het
Sdhaf1 T C 7: 30,322,043 D96G probably benign Het
Serpinb6b T A 13: 32,968,667 M53K probably damaging Het
Sh2d6 A T 6: 72,517,164 L147Q probably benign Het
Slc19a2 T A 1: 164,260,876 C298S probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
St8sia2 T A 7: 73,960,902 Q211L possibly damaging Het
Sult2a2 T C 7: 13,734,897 I96T possibly damaging Het
Tab2 G T 10: 7,907,483 H678Q probably damaging Het
Tnfaip6 A G 2: 52,038,216 E14G probably benign Het
Trip11 A T 12: 101,885,198 L869H probably damaging Het
Tslp T C 18: 32,819,080 Y133H not run Het
Ttn T C 2: 76,740,990 I26520V probably damaging Het
Ttn A G 2: 76,932,143 V3374A unknown Het
Tubgcp2 T A 7: 140,007,924 I263F possibly damaging Het
Uaca A G 9: 60,870,110 E593G probably damaging Het
Unc13b C T 4: 43,172,235 T1021I unknown Het
Ush1c T A 7: 46,225,555 I131F probably benign Het
Usp24 C A 4: 106,379,107 D997E probably benign Het
Usp54 T C 14: 20,577,040 T517A probably benign Het
Vmn1r151 A T 7: 22,499,080 M200K possibly damaging Het
Vmn2r43 T C 7: 8,255,329 D295G probably damaging Het
Vmn2r70 G A 7: 85,563,868 P444S probably damaging Het
Vmn2r85 G T 10: 130,418,980 P612T probably damaging Het
Vps13d A T 4: 145,148,747 V1736D Het
Zbtb11 A T 16: 55,990,487 H336L probably benign Het
Other mutations in Mdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Mdc1 APN 17 35848020 missense probably benign 0.04
IGL01662:Mdc1 APN 17 35852505 missense probably benign 0.00
IGL01931:Mdc1 APN 17 35848231 missense probably benign 0.00
IGL02542:Mdc1 APN 17 35853156 missense probably damaging 0.96
IGL02823:Mdc1 APN 17 35852923 missense probably damaging 0.99
IGL03411:Mdc1 APN 17 35853126 missense probably benign 0.06
IGL02799:Mdc1 UTSW 17 35846191 missense possibly damaging 0.86
PIT4362001:Mdc1 UTSW 17 35844469 missense possibly damaging 0.72
R0054:Mdc1 UTSW 17 35849033 missense probably benign 0.00
R0129:Mdc1 UTSW 17 35854445 missense probably benign 0.04
R0131:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R0131:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R0132:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R1406:Mdc1 UTSW 17 35853532 missense probably benign 0.10
R1406:Mdc1 UTSW 17 35853532 missense probably benign 0.10
R1597:Mdc1 UTSW 17 35845866 missense probably damaging 1.00
R1721:Mdc1 UTSW 17 35847826 missense possibly damaging 0.85
R1888:Mdc1 UTSW 17 35854225 missense probably benign 0.03
R1888:Mdc1 UTSW 17 35854225 missense probably benign 0.03
R1912:Mdc1 UTSW 17 35844538 missense probably benign 0.00
R1912:Mdc1 UTSW 17 35850811 missense probably benign 0.19
R1977:Mdc1 UTSW 17 35850930 missense probably benign 0.01
R2121:Mdc1 UTSW 17 35847943 missense probably benign 0.03
R2122:Mdc1 UTSW 17 35847943 missense probably benign 0.03
R2357:Mdc1 UTSW 17 35847445 missense probably benign 0.00
R2842:Mdc1 UTSW 17 35848794 missense probably benign 0.01
R2851:Mdc1 UTSW 17 35849010 missense probably benign 0.04
R2852:Mdc1 UTSW 17 35849010 missense probably benign 0.04
R2964:Mdc1 UTSW 17 35853637 missense possibly damaging 0.72
R2996:Mdc1 UTSW 17 35847893 unclassified probably benign
R3752:Mdc1 UTSW 17 35845929 missense probably damaging 1.00
R4234:Mdc1 UTSW 17 35848824 missense probably benign 0.00
R4641:Mdc1 UTSW 17 35857469 missense probably benign 0.09
R4706:Mdc1 UTSW 17 35852779 missense probably damaging 0.99
R4809:Mdc1 UTSW 17 35849101 critical splice donor site probably null
R4833:Mdc1 UTSW 17 35850394 missense probably benign 0.20
R5032:Mdc1 UTSW 17 35850589 missense probably benign 0.00
R5047:Mdc1 UTSW 17 35847844 missense probably benign 0.00
R5086:Mdc1 UTSW 17 35848630 missense probably benign 0.00
R5172:Mdc1 UTSW 17 35853090 missense probably benign 0.00
R5254:Mdc1 UTSW 17 35847922 missense probably benign 0.00
R5473:Mdc1 UTSW 17 35848060 missense probably benign 0.01
R5550:Mdc1 UTSW 17 35845884 missense possibly damaging 0.64
R5561:Mdc1 UTSW 17 35848546 missense probably benign 0.00
R5888:Mdc1 UTSW 17 35847820 missense probably benign 0.01
R6020:Mdc1 UTSW 17 35848633 missense probably benign 0.04
R6020:Mdc1 UTSW 17 35857572 missense probably benign 0.01
R6219:Mdc1 UTSW 17 35850674 missense probably benign 0.10
R7053:Mdc1 UTSW 17 35846326 missense probably benign 0.00
R7073:Mdc1 UTSW 17 35854068 missense probably benign 0.18
R7077:Mdc1 UTSW 17 35845947 missense probably damaging 0.97
R7443:Mdc1 UTSW 17 35850820 missense probably damaging 0.98
R7467:Mdc1 UTSW 17 35844556 missense probably benign 0.29
R7549:Mdc1 UTSW 17 35848857 missense probably null 0.04
R7655:Mdc1 UTSW 17 35850881 missense probably benign 0.01
R7656:Mdc1 UTSW 17 35850881 missense probably benign 0.01
RF025:Mdc1 UTSW 17 35854407 critical splice acceptor site probably benign
X0022:Mdc1 UTSW 17 35850937 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAACAGCCTGTTATCCCTGAAC -3'
(R):5'- ATGTCCTTCCCTGAGTGACC -3'

Sequencing Primer
(F):5'- GTTATCCCTGAACCTAGGGC -3'
(R):5'- CCTGAGTGACCAGAGCTGTAG -3'
Posted On2019-10-07