Incidental Mutation 'R7425:Kcnb2'
ID575960
Institutional Source Beutler Lab
Gene Symbol Kcnb2
Ensembl Gene ENSMUSG00000092083
Gene Namepotassium voltage gated channel, Shab-related subfamily, member 2
Synonyms9630047L19Rik, Kv2.2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7425 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location15287254-15723750 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 15709807 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 301 (Q301P)
Ref Sequence ENSEMBL: ENSMUSP00000126656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170146] [ENSMUST00000175681]
Predicted Effect probably damaging
Transcript: ENSMUST00000170146
AA Change: Q301P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000175681
AA Change: Q301P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135382
Gene: ENSMUSG00000092083
AA Change: Q301P

DomainStartEndE-ValueType
BTB 35 144 2.59e-14 SMART
low complexity region 150 166 N/A INTRINSIC
Pfam:Ion_trans 192 428 1.7e-51 PFAM
Pfam:Ion_trans_2 336 422 2.5e-13 PFAM
Pfam:Kv2channel 471 755 7.7e-149 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shab-related subfamily. This member is a delayed rectifier potassium channel. The gene is expressed in gastrointestinal smooth muscle cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit neurological abnormalities when compared with controls, including an abnormal sleep/wake cycle, decreased exploratory and locomotor activity, and a motor strength deficit. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,695 E215G probably benign Het
4932438A13Rik T A 3: 36,948,341 H1478Q probably benign Het
4932438A13Rik A T 3: 36,983,394 H2448L probably benign Het
Adam8 T A 7: 139,992,481 probably benign Het
Ankrd35 A G 3: 96,684,788 S797G not run Het
Anxa3 T A 5: 96,834,821 H259Q probably benign Het
Ap3d1 T A 10: 80,721,592 Q302L probably damaging Het
Atg2a T C 19: 6,255,652 V1294A probably benign Het
Atp13a5 G A 16: 29,297,460 Q613* probably null Het
Bmpr2 T G 1: 59,867,351 N534K probably benign Het
C1qbp T C 11: 70,978,246 probably null Het
C1qbp G T 11: 70,978,247 probably null Het
C1ql3 T G 2: 13,010,418 K144Q possibly damaging Het
C3 T C 17: 57,204,039 M1656V possibly damaging Het
Cand1 A T 10: 119,216,243 Y252N probably benign Het
Capn13 T C 17: 73,318,058 I632M probably benign Het
Catsperb A G 12: 101,591,498 E776G probably damaging Het
Ccnl1 A T 3: 65,948,758 V242D probably damaging Het
Cd68 T C 11: 69,665,112 D200G probably benign Het
Cela3a T C 4: 137,405,588 N118D probably benign Het
Celsr2 A G 3: 108,402,457 C1609R probably damaging Het
Cep85l G C 10: 53,301,570 Q458E probably damaging Het
Cnga1 T G 5: 72,609,525 E190D probably benign Het
Cntnap3 G A 13: 64,758,252 R847C probably damaging Het
Cntrob G A 11: 69,314,734 Q425* probably null Het
Commd9 G A 2: 101,899,900 W128* probably null Het
Csnk1a1 C T 18: 61,585,259 S352L unknown Het
Dact2 A G 17: 14,196,331 S536P probably damaging Het
Ddx25 A G 9: 35,554,586 I113T probably benign Het
Dscam T A 16: 96,629,398 D1630V probably damaging Het
Fndc7 A C 3: 108,876,659 F211L probably benign Het
Fryl T C 5: 73,104,748 T559A probably damaging Het
Hpx C A 7: 105,591,861 D402Y probably damaging Het
Ints13 A G 6: 146,574,700 probably null Het
Ipcef1 T C 10: 6,956,066 K76E probably damaging Het
Lamp3 C T 16: 19,699,612 probably null Het
Lmod2 A T 6: 24,603,476 H150L probably benign Het
Lrch3 T C 16: 33,005,707 F718S probably damaging Het
Mms22l T C 4: 24,596,287 V1082A probably benign Het
Nbas G T 12: 13,469,880 V1598L probably damaging Het
Nrxn3 C T 12: 89,513,100 R671* probably null Het
Olfr1215 A T 2: 89,002,200 F29L Het
Olfr1441 A C 19: 12,422,840 H177P probably damaging Het
Olfr214 A T 6: 116,556,437 E4V possibly damaging Het
Olfr48 A G 2: 89,844,445 L176P probably damaging Het
Olfr671 A T 7: 104,975,061 L312* probably null Het
Pcdhga6 T A 18: 37,708,566 N446K probably damaging Het
Phlpp1 A T 1: 106,392,573 I1433F probably benign Het
Pla2g6 G A 15: 79,308,733 R245C probably damaging Het
Rgl3 G A 9: 21,976,827 Q464* probably null Het
Ryr2 T C 13: 11,705,644 D2706G probably benign Het
Sbf2 G A 7: 110,375,777 Q718* probably null Het
Sdad1 T C 5: 92,300,121 T252A probably benign Het
Sgk1 T C 10: 21,994,110 L16P probably damaging Het
Slc38a8 A G 8: 119,485,588 S339P possibly damaging Het
Slc44a4 T C 17: 34,921,691 S287P possibly damaging Het
Syne1 T C 10: 5,425,760 I111V probably damaging Het
Synm A C 7: 67,733,446 S1489R probably damaging Het
Tfb2m A G 1: 179,537,704 F232L probably benign Het
Traf3 A T 12: 111,260,661 K328* probably null Het
Trim38 C A 13: 23,788,382 Q229K probably benign Het
Vcan A G 13: 89,689,832 I2531T probably damaging Het
Virma T A 4: 11,546,211 I1683N possibly damaging Het
Vmn1r18 A T 6: 57,390,566 M1K probably null Het
Vmn2r87 T C 10: 130,478,892 N275S probably damaging Het
Vps13a T A 19: 16,723,702 H701L probably benign Het
Vrk3 T A 7: 44,770,924 probably null Het
Zfp993 T A 4: 146,657,641 S141T possibly damaging Het
Other mutations in Kcnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Kcnb2 APN 1 15711012 missense probably benign 0.02
IGL01321:Kcnb2 APN 1 15312923 missense probably benign 0.09
IGL01353:Kcnb2 APN 1 15710824 missense probably benign 0.02
IGL01990:Kcnb2 APN 1 15312954 missense probably benign 0.19
IGL02008:Kcnb2 APN 1 15710809 missense probably benign 0.00
IGL02120:Kcnb2 APN 1 15709861 missense probably damaging 0.98
IGL02370:Kcnb2 APN 1 15710935 missense probably benign
IGL02526:Kcnb2 APN 1 15710755 missense probably damaging 1.00
IGL02859:Kcnb2 APN 1 15710506 missense probably damaging 1.00
IGL03039:Kcnb2 APN 1 15711211 missense probably benign
IGL03144:Kcnb2 APN 1 15709888 missense probably damaging 1.00
F5770:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
PIT4131001:Kcnb2 UTSW 1 15312976 missense possibly damaging 0.92
R0266:Kcnb2 UTSW 1 15712913 unclassified probably benign
R0538:Kcnb2 UTSW 1 15712884 unclassified probably benign
R0611:Kcnb2 UTSW 1 15710440 missense probably benign 0.07
R1542:Kcnb2 UTSW 1 15710788 missense probably benign 0.01
R1732:Kcnb2 UTSW 1 15709755 missense probably benign 0.02
R1995:Kcnb2 UTSW 1 15709766 missense possibly damaging 0.66
R2166:Kcnb2 UTSW 1 15711316 missense possibly damaging 0.82
R2444:Kcnb2 UTSW 1 15709567 missense probably benign
R3025:Kcnb2 UTSW 1 15710835 missense possibly damaging 0.87
R3886:Kcnb2 UTSW 1 15710415 missense probably damaging 1.00
R5010:Kcnb2 UTSW 1 15312962 missense probably benign 0.09
R5039:Kcnb2 UTSW 1 15709500 missense probably damaging 1.00
R5096:Kcnb2 UTSW 1 15710844 missense probably benign 0.45
R5444:Kcnb2 UTSW 1 15711492 missense probably benign
R5926:Kcnb2 UTSW 1 15313011 missense probably benign 0.01
R6010:Kcnb2 UTSW 1 15710566 missense possibly damaging 0.85
R6371:Kcnb2 UTSW 1 15711212 missense probably benign
R6724:Kcnb2 UTSW 1 15710440 missense probably damaging 1.00
R6981:Kcnb2 UTSW 1 15710256 missense probably damaging 1.00
R7043:Kcnb2 UTSW 1 15312926 missense probably benign
R7352:Kcnb2 UTSW 1 15710611 missense probably benign
R7419:Kcnb2 UTSW 1 15711027 missense possibly damaging 0.94
R7606:Kcnb2 UTSW 1 15312840 missense probably damaging 1.00
V7580:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
V7581:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
V7582:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
V7583:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
Z1088:Kcnb2 UTSW 1 15710091 missense probably benign 0.03
Z1088:Kcnb2 UTSW 1 15711028 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGCCTGGTTTACCATGGAGTATC -3'
(R):5'- CCCACCAAAATGATGCAGGG -3'

Sequencing Primer
(F):5'- ACCATGGAGTATCTTTTACGATTCC -3'
(R):5'- CTGGTGAATTTGGTAGCATCTTCATC -3'
Posted On2019-10-07