Incidental Mutation 'R7425:Olfr214'
ID575985
Institutional Source Beutler Lab
Gene Symbol Olfr214
Ensembl Gene ENSMUSG00000051046
Gene Nameolfactory receptor 214
SynonymsMOR119-1, GA_x54KRFPKN04-58190962-58191900
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R7425 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location116554235-116560611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116556437 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 4 (E4V)
Ref Sequence ENSEMBL: ENSMUSP00000145465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060204] [ENSMUST00000122096] [ENSMUST00000203867] [ENSMUST00000214699] [ENSMUST00000215846] [ENSMUST00000217313]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060204
AA Change: E4V

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000052730
Gene: ENSMUSG00000051046
AA Change: E4V

DomainStartEndE-ValueType
Pfam:7tm_4 39 316 4.7e-47 PFAM
Pfam:7tm_1 49 298 5.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122096
SMART Domains Protein: ENSMUSP00000145194
Gene: ENSMUSG00000107906

DomainStartEndE-ValueType
DEXDc 57 254 2.4e-59 SMART
HELICc 291 372 6.6e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000203867
AA Change: E4V

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000145465
Gene: ENSMUSG00000051046
AA Change: E4V

DomainStartEndE-ValueType
Pfam:7tm_4 39 316 4.7e-47 PFAM
Pfam:7tm_1 49 298 5.9e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214699
AA Change: E4V

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215846
AA Change: E4V

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217313
AA Change: E4V

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,695 E215G probably benign Het
4932438A13Rik T A 3: 36,948,341 H1478Q probably benign Het
4932438A13Rik A T 3: 36,983,394 H2448L probably benign Het
Adam8 T A 7: 139,992,481 probably benign Het
Ankrd35 A G 3: 96,684,788 S797G not run Het
Anxa3 T A 5: 96,834,821 H259Q probably benign Het
Ap3d1 T A 10: 80,721,592 Q302L probably damaging Het
Atg2a T C 19: 6,255,652 V1294A probably benign Het
Atp13a5 G A 16: 29,297,460 Q613* probably null Het
Bmpr2 T G 1: 59,867,351 N534K probably benign Het
C1qbp T C 11: 70,978,246 probably null Het
C1qbp G T 11: 70,978,247 probably null Het
C1ql3 T G 2: 13,010,418 K144Q possibly damaging Het
C3 T C 17: 57,204,039 M1656V possibly damaging Het
Cand1 A T 10: 119,216,243 Y252N probably benign Het
Capn13 T C 17: 73,318,058 I632M probably benign Het
Catsperb A G 12: 101,591,498 E776G probably damaging Het
Ccnl1 A T 3: 65,948,758 V242D probably damaging Het
Cd68 T C 11: 69,665,112 D200G probably benign Het
Cela3a T C 4: 137,405,588 N118D probably benign Het
Celsr2 A G 3: 108,402,457 C1609R probably damaging Het
Cep85l G C 10: 53,301,570 Q458E probably damaging Het
Cnga1 T G 5: 72,609,525 E190D probably benign Het
Cntnap3 G A 13: 64,758,252 R847C probably damaging Het
Cntrob G A 11: 69,314,734 Q425* probably null Het
Commd9 G A 2: 101,899,900 W128* probably null Het
Csnk1a1 C T 18: 61,585,259 S352L unknown Het
Dact2 A G 17: 14,196,331 S536P probably damaging Het
Ddx25 A G 9: 35,554,586 I113T probably benign Het
Dscam T A 16: 96,629,398 D1630V probably damaging Het
Fndc7 A C 3: 108,876,659 F211L probably benign Het
Fryl T C 5: 73,104,748 T559A probably damaging Het
Hpx C A 7: 105,591,861 D402Y probably damaging Het
Ints13 A G 6: 146,574,700 probably null Het
Ipcef1 T C 10: 6,956,066 K76E probably damaging Het
Kcnb2 A C 1: 15,709,807 Q301P probably damaging Het
Lamp3 C T 16: 19,699,612 probably null Het
Lmod2 A T 6: 24,603,476 H150L probably benign Het
Lrch3 T C 16: 33,005,707 F718S probably damaging Het
Mms22l T C 4: 24,596,287 V1082A probably benign Het
Nbas G T 12: 13,469,880 V1598L probably damaging Het
Nrxn3 C T 12: 89,513,100 R671* probably null Het
Olfr1215 A T 2: 89,002,200 F29L Het
Olfr1441 A C 19: 12,422,840 H177P probably damaging Het
Olfr48 A G 2: 89,844,445 L176P probably damaging Het
Olfr671 A T 7: 104,975,061 L312* probably null Het
Pcdhga6 T A 18: 37,708,566 N446K probably damaging Het
Phlpp1 A T 1: 106,392,573 I1433F probably benign Het
Pla2g6 G A 15: 79,308,733 R245C probably damaging Het
Rgl3 G A 9: 21,976,827 Q464* probably null Het
Ryr2 T C 13: 11,705,644 D2706G probably benign Het
Sbf2 G A 7: 110,375,777 Q718* probably null Het
Sdad1 T C 5: 92,300,121 T252A probably benign Het
Sgk1 T C 10: 21,994,110 L16P probably damaging Het
Slc38a8 A G 8: 119,485,588 S339P possibly damaging Het
Slc44a4 T C 17: 34,921,691 S287P possibly damaging Het
Syne1 T C 10: 5,425,760 I111V probably damaging Het
Synm A C 7: 67,733,446 S1489R probably damaging Het
Tfb2m A G 1: 179,537,704 F232L probably benign Het
Traf3 A T 12: 111,260,661 K328* probably null Het
Trim38 C A 13: 23,788,382 Q229K probably benign Het
Vcan A G 13: 89,689,832 I2531T probably damaging Het
Virma T A 4: 11,546,211 I1683N possibly damaging Het
Vmn1r18 A T 6: 57,390,566 M1K probably null Het
Vmn2r87 T C 10: 130,478,892 N275S probably damaging Het
Vps13a T A 19: 16,723,702 H701L probably benign Het
Vrk3 T A 7: 44,770,924 probably null Het
Zfp993 T A 4: 146,657,641 S141T possibly damaging Het
Other mutations in Olfr214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Olfr214 APN 6 116557066 missense probably benign
IGL01837:Olfr214 APN 6 116556846 nonsense probably null
IGL02523:Olfr214 APN 6 116557093 missense probably benign 0.03
R0027:Olfr214 UTSW 6 116556949 missense probably damaging 0.99
R0616:Olfr214 UTSW 6 116556928 missense probably benign 0.00
R1121:Olfr214 UTSW 6 116557229 missense probably damaging 0.99
R1555:Olfr214 UTSW 6 116556826 missense probably damaging 1.00
R1691:Olfr214 UTSW 6 116556577 missense probably benign 0.00
R2196:Olfr214 UTSW 6 116556617 missense probably damaging 0.99
R3080:Olfr214 UTSW 6 116557217 missense probably damaging 0.98
R5416:Olfr214 UTSW 6 116557205 missense probably damaging 1.00
R5706:Olfr214 UTSW 6 116557113 missense probably damaging 1.00
R6848:Olfr214 UTSW 6 116556775 missense probably damaging 0.98
R8059:Olfr214 UTSW 6 116556473 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TTGTATTTCAGAAATGAGAGAAGGGA -3'
(R):5'- GGATCGGACCACGTGATG -3'

Sequencing Primer
(F):5'- CTCCTAGTGAGGCTGAACAAG -3'
(R):5'- CCACGTGATGGCGATGATG -3'
Posted On2019-10-07