Incidental Mutation 'R7425:Sgk1'
ID575998
Institutional Source Beutler Lab
Gene Symbol Sgk1
Ensembl Gene ENSMUSG00000019970
Gene Nameserum/glucocorticoid regulated kinase 1
SynonymsSgk, Sgk1
Accession Numbers

Ncbi RefSeq: NM_001161845.2, NM_001161847.2, NM_001161848.2, NM_001161849.2, NM_001161850.2, NM_011361.3; MGI:1340062

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7425 (G1)
Quality Score176.009
Status Not validated
Chromosome10
Chromosomal Location21882184-21999903 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21994110 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 16 (L16P)
Ref Sequence ENSEMBL: ENSMUSP00000090343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020145] [ENSMUST00000092673] [ENSMUST00000100036] [ENSMUST00000120509] [ENSMUST00000124350] [ENSMUST00000142174] [ENSMUST00000150089] [ENSMUST00000164659]
Predicted Effect probably benign
Transcript: ENSMUST00000020145
SMART Domains Protein: ENSMUSP00000020145
Gene: ENSMUSG00000019970

DomainStartEndE-ValueType
Blast:S_TKc 36 72 4e-10 BLAST
low complexity region 73 80 N/A INTRINSIC
S_TKc 98 355 6.15e-106 SMART
S_TK_X 356 425 2.51e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000092673
AA Change: L16P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090343
Gene: ENSMUSG00000019970
AA Change: L16P

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
Blast:S_TKc 50 86 5e-10 BLAST
low complexity region 87 94 N/A INTRINSIC
S_TKc 112 369 6.15e-106 SMART
S_TK_X 370 439 2.51e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100036
SMART Domains Protein: ENSMUSP00000097614
Gene: ENSMUSG00000019970

DomainStartEndE-ValueType
Blast:S_TKc 22 58 5e-10 BLAST
low complexity region 59 66 N/A INTRINSIC
S_TKc 84 341 6.15e-106 SMART
S_TK_X 342 411 2.51e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120509
SMART Domains Protein: ENSMUSP00000114074
Gene: ENSMUSG00000019970

DomainStartEndE-ValueType
Blast:S_TKc 129 165 1e-9 BLAST
low complexity region 166 173 N/A INTRINSIC
S_TKc 191 448 6.15e-106 SMART
S_TK_X 449 518 2.51e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124203
Predicted Effect probably benign
Transcript: ENSMUST00000124350
SMART Domains Protein: ENSMUSP00000114691
Gene: ENSMUSG00000019970

DomainStartEndE-ValueType
Blast:S_TKc 9 45 2e-12 BLAST
low complexity region 46 53 N/A INTRINSIC
Pfam:Pkinase 71 266 3.2e-62 PFAM
Pfam:Pkinase_Tyr 71 266 4.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142174
SMART Domains Protein: ENSMUSP00000120882
Gene: ENSMUSG00000019970

DomainStartEndE-ValueType
Blast:S_TKc 9 45 3e-14 BLAST
PDB:3HDN|A 33 82 7e-18 PDB
SCOP:d1koba_ 43 82 4e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150089
SMART Domains Protein: ENSMUSP00000115073
Gene: ENSMUSG00000019970

DomainStartEndE-ValueType
Blast:S_TKc 22 58 4e-14 BLAST
PDB:3HDN|A 46 89 3e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000164659
SMART Domains Protein: ENSMUSP00000128873
Gene: ENSMUSG00000019970

DomainStartEndE-ValueType
Blast:S_TKc 9 45 5e-10 BLAST
low complexity region 46 53 N/A INTRINSIC
S_TKc 71 328 6.15e-106 SMART
S_TK_X 329 398 2.51e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype Strain: 3846797; 2445418
FUNCTION: This gene encodes a serine/threonine protein kinase that plays an important role in cellular stress response. This kinase activates certain potassium, sodium, and chloride channels, suggesting an involvement in the regulation of processes such as cell survival, neuronal excitability, and renal sodium excretion. This enzyme is activated by protein phosphorylation and degraded via the ubiquitination and proteasome pathway. Multiple transcript variants encoding different isoforms have been found for this gene. A pseudogene of this gene was identified on chromosome 12. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a disruption in this gene display an essentially normal phenotype. Sodium retention is compromised on a low salt diet. [provided by MGI curators]
Allele List at MGI

All alleles(143) : Targeted(6) Gene trapped(137)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,695 E215G probably benign Het
4932438A13Rik T A 3: 36,948,341 H1478Q probably benign Het
4932438A13Rik A T 3: 36,983,394 H2448L probably benign Het
Adam8 T A 7: 139,992,481 probably benign Het
Ankrd35 A G 3: 96,684,788 S797G not run Het
Anxa3 T A 5: 96,834,821 H259Q probably benign Het
Ap3d1 T A 10: 80,721,592 Q302L probably damaging Het
Atg2a T C 19: 6,255,652 V1294A probably benign Het
Atp13a5 G A 16: 29,297,460 Q613* probably null Het
Bmpr2 T G 1: 59,867,351 N534K probably benign Het
C1qbp T C 11: 70,978,246 probably null Het
C1qbp G T 11: 70,978,247 probably null Het
C1ql3 T G 2: 13,010,418 K144Q possibly damaging Het
C3 T C 17: 57,204,039 M1656V possibly damaging Het
Cand1 A T 10: 119,216,243 Y252N probably benign Het
Capn13 T C 17: 73,318,058 I632M probably benign Het
Catsperb A G 12: 101,591,498 E776G probably damaging Het
Ccnl1 A T 3: 65,948,758 V242D probably damaging Het
Cd68 T C 11: 69,665,112 D200G probably benign Het
Cela3a T C 4: 137,405,588 N118D probably benign Het
Celsr2 A G 3: 108,402,457 C1609R probably damaging Het
Cep85l G C 10: 53,301,570 Q458E probably damaging Het
Cnga1 T G 5: 72,609,525 E190D probably benign Het
Cntnap3 G A 13: 64,758,252 R847C probably damaging Het
Cntrob G A 11: 69,314,734 Q425* probably null Het
Commd9 G A 2: 101,899,900 W128* probably null Het
Csnk1a1 C T 18: 61,585,259 S352L unknown Het
Dact2 A G 17: 14,196,331 S536P probably damaging Het
Ddx25 A G 9: 35,554,586 I113T probably benign Het
Dscam T A 16: 96,629,398 D1630V probably damaging Het
Fndc7 A C 3: 108,876,659 F211L probably benign Het
Fryl T C 5: 73,104,748 T559A probably damaging Het
Hpx C A 7: 105,591,861 D402Y probably damaging Het
Ints13 A G 6: 146,574,700 probably null Het
Ipcef1 T C 10: 6,956,066 K76E probably damaging Het
Kcnb2 A C 1: 15,709,807 Q301P probably damaging Het
Lamp3 C T 16: 19,699,612 probably null Het
Lmod2 A T 6: 24,603,476 H150L probably benign Het
Lrch3 T C 16: 33,005,707 F718S probably damaging Het
Mms22l T C 4: 24,596,287 V1082A probably benign Het
Nbas G T 12: 13,469,880 V1598L probably damaging Het
Nrxn3 C T 12: 89,513,100 R671* probably null Het
Olfr1215 A T 2: 89,002,200 F29L Het
Olfr1441 A C 19: 12,422,840 H177P probably damaging Het
Olfr214 A T 6: 116,556,437 E4V possibly damaging Het
Olfr48 A G 2: 89,844,445 L176P probably damaging Het
Olfr671 A T 7: 104,975,061 L312* probably null Het
Pcdhga6 T A 18: 37,708,566 N446K probably damaging Het
Phlpp1 A T 1: 106,392,573 I1433F probably benign Het
Pla2g6 G A 15: 79,308,733 R245C probably damaging Het
Rgl3 G A 9: 21,976,827 Q464* probably null Het
Ryr2 T C 13: 11,705,644 D2706G probably benign Het
Sbf2 G A 7: 110,375,777 Q718* probably null Het
Sdad1 T C 5: 92,300,121 T252A probably benign Het
Slc38a8 A G 8: 119,485,588 S339P possibly damaging Het
Slc44a4 T C 17: 34,921,691 S287P possibly damaging Het
Syne1 T C 10: 5,425,760 I111V probably damaging Het
Synm A C 7: 67,733,446 S1489R probably damaging Het
Tfb2m A G 1: 179,537,704 F232L probably benign Het
Traf3 A T 12: 111,260,661 K328* probably null Het
Trim38 C A 13: 23,788,382 Q229K probably benign Het
Vcan A G 13: 89,689,832 I2531T probably damaging Het
Virma T A 4: 11,546,211 I1683N possibly damaging Het
Vmn1r18 A T 6: 57,390,566 M1K probably null Het
Vmn2r87 T C 10: 130,478,892 N275S probably damaging Het
Vps13a T A 19: 16,723,702 H701L probably benign Het
Vrk3 T A 7: 44,770,924 probably null Het
Zfp993 T A 4: 146,657,641 S141T possibly damaging Het
Other mutations in Sgk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Sgk1 APN 10 21995541 missense probably damaging 1.00
IGL02670:Sgk1 APN 10 21928546 missense probably benign
IGL03220:Sgk1 APN 10 21997391 missense probably null 1.00
R0010:Sgk1 UTSW 10 21997438 critical splice donor site probably null
R0010:Sgk1 UTSW 10 21997438 critical splice donor site probably null
R0467:Sgk1 UTSW 10 21996358 splice site probably benign
R0479:Sgk1 UTSW 10 21996310 missense probably benign 0.00
R0650:Sgk1 UTSW 10 21882657 missense probably damaging 0.98
R0652:Sgk1 UTSW 10 21882657 missense probably damaging 0.98
R0688:Sgk1 UTSW 10 21998160 missense probably benign
R0990:Sgk1 UTSW 10 21997086 missense probably damaging 1.00
R1769:Sgk1 UTSW 10 21997108 splice site probably benign
R2009:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R2218:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R2314:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R2909:Sgk1 UTSW 10 21994816 missense probably benign
R2915:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R3176:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R3177:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R3276:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R3277:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R3802:Sgk1 UTSW 10 21997412 missense probably damaging 1.00
R5974:Sgk1 UTSW 10 21996249 missense probably damaging 1.00
R6943:Sgk1 UTSW 10 21882694 missense probably damaging 0.99
R7360:Sgk1 UTSW 10 21994073 missense probably benign 0.01
R7665:Sgk1 UTSW 10 21996662 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACAAGGGCCATTTGTTTG -3'
(R):5'- GAGAGCCTCGGTGATTTTCC -3'

Sequencing Primer
(F):5'- CACAAGGGCCATTTGTTTGTTTTG -3'
(R):5'- GAGAGCCTCGGTGATTTTCCATTTC -3'
Posted On2019-10-07