Incidental Mutation 'R7425:Cntrob'
ID 576003
Institutional Source Beutler Lab
Gene Symbol Cntrob
Ensembl Gene ENSMUSG00000032782
Gene Name centrobin, centrosomal BRCA2 interacting protein
Synonyms Nip2, 9830165K03Rik, Lip8
MMRRC Submission 045503-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.175) question?
Stock # R7425 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 69190313-69214601 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 69205560 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 425 (Q425*)
Ref Sequence ENSEMBL: ENSMUSP00000090651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092973] [ENSMUST00000123176]
AlphaFold Q8CB62
Predicted Effect probably null
Transcript: ENSMUST00000092973
AA Change: Q425*
SMART Domains Protein: ENSMUSP00000090651
Gene: ENSMUSG00000032782
AA Change: Q425*

DomainStartEndE-ValueType
coiled coil region 191 218 N/A INTRINSIC
coiled coil region 249 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123176
Predicted Effect probably benign
Transcript: ENSMUST00000176938
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein that interacts with BRCA2, and is required for centriole duplication and cytokinesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 137,771,456 (GRCm39) E215G probably benign Het
Adam8 T A 7: 139,572,394 (GRCm39) probably benign Het
Ankrd35 A G 3: 96,592,104 (GRCm39) S797G not run Het
Anxa3 T A 5: 96,982,680 (GRCm39) H259Q probably benign Het
Ap3d1 T A 10: 80,557,426 (GRCm39) Q302L probably damaging Het
Atg2a T C 19: 6,305,682 (GRCm39) V1294A probably benign Het
Atp13a5 G A 16: 29,116,278 (GRCm39) Q613* probably null Het
Bltp1 T A 3: 37,002,490 (GRCm39) H1478Q probably benign Het
Bltp1 A T 3: 37,037,543 (GRCm39) H2448L probably benign Het
Bmpr2 T G 1: 59,906,510 (GRCm39) N534K probably benign Het
C1qbp T C 11: 70,869,072 (GRCm39) probably null Het
C1qbp G T 11: 70,869,073 (GRCm39) probably null Het
C1ql3 T G 2: 13,015,229 (GRCm39) K144Q possibly damaging Het
C3 T C 17: 57,511,039 (GRCm39) M1656V possibly damaging Het
Cand1 A T 10: 119,052,148 (GRCm39) Y252N probably benign Het
Capn13 T C 17: 73,625,053 (GRCm39) I632M probably benign Het
Catsperb A G 12: 101,557,757 (GRCm39) E776G probably damaging Het
Ccnl1 A T 3: 65,856,179 (GRCm39) V242D probably damaging Het
Cd68 T C 11: 69,555,938 (GRCm39) D200G probably benign Het
Cela3a T C 4: 137,132,899 (GRCm39) N118D probably benign Het
Celsr2 A G 3: 108,309,773 (GRCm39) C1609R probably damaging Het
Cep85l G C 10: 53,177,666 (GRCm39) Q458E probably damaging Het
Cnga1 T G 5: 72,766,868 (GRCm39) E190D probably benign Het
Cntnap3 G A 13: 64,906,066 (GRCm39) R847C probably damaging Het
Commd9 G A 2: 101,730,245 (GRCm39) W128* probably null Het
Csnk1a1 C T 18: 61,718,330 (GRCm39) S352L unknown Het
Dact2 A G 17: 14,416,593 (GRCm39) S536P probably damaging Het
Ddx25 A G 9: 35,465,882 (GRCm39) I113T probably benign Het
Dscam T A 16: 96,430,598 (GRCm39) D1630V probably damaging Het
Fndc7 A C 3: 108,783,975 (GRCm39) F211L probably benign Het
Fryl T C 5: 73,262,091 (GRCm39) T559A probably damaging Het
Hpx C A 7: 105,241,068 (GRCm39) D402Y probably damaging Het
Ints13 A G 6: 146,476,198 (GRCm39) probably null Het
Ipcef1 T C 10: 6,906,066 (GRCm39) K76E probably damaging Het
Kcnb2 A C 1: 15,780,031 (GRCm39) Q301P probably damaging Het
Lamp3 C T 16: 19,518,362 (GRCm39) probably null Het
Lmod2 A T 6: 24,603,475 (GRCm39) H150L probably benign Het
Lrch3 T C 16: 32,826,077 (GRCm39) F718S probably damaging Het
Mms22l T C 4: 24,596,287 (GRCm39) V1082A probably benign Het
Nbas G T 12: 13,519,881 (GRCm39) V1598L probably damaging Het
Nrxn3 C T 12: 89,479,870 (GRCm39) R671* probably null Het
Or4c110 A T 2: 88,832,544 (GRCm39) F29L Het
Or4c58 A G 2: 89,674,789 (GRCm39) L176P probably damaging Het
Or52e8 A T 7: 104,624,268 (GRCm39) L312* probably null Het
Or5a3 A C 19: 12,400,204 (GRCm39) H177P probably damaging Het
Or6d14 A T 6: 116,533,398 (GRCm39) E4V possibly damaging Het
Pcdhga6 T A 18: 37,841,619 (GRCm39) N446K probably damaging Het
Phlpp1 A T 1: 106,320,303 (GRCm39) I1433F probably benign Het
Pla2g6 G A 15: 79,192,933 (GRCm39) R245C probably damaging Het
Rgl3 G A 9: 21,888,123 (GRCm39) Q464* probably null Het
Ryr2 T C 13: 11,720,530 (GRCm39) D2706G probably benign Het
Sbf2 G A 7: 109,974,984 (GRCm39) Q718* probably null Het
Sdad1 T C 5: 92,447,980 (GRCm39) T252A probably benign Het
Sgk1 T C 10: 21,870,009 (GRCm39) L16P probably damaging Het
Slc38a8 A G 8: 120,212,327 (GRCm39) S339P possibly damaging Het
Slc44a4 T C 17: 35,140,667 (GRCm39) S287P possibly damaging Het
Syne1 T C 10: 5,375,760 (GRCm39) I111V probably damaging Het
Synm A C 7: 67,383,194 (GRCm39) S1489R probably damaging Het
Tfb2m A G 1: 179,365,269 (GRCm39) F232L probably benign Het
Traf3 A T 12: 111,227,095 (GRCm39) K328* probably null Het
Trim38 C A 13: 23,972,365 (GRCm39) Q229K probably benign Het
Vcan A G 13: 89,837,951 (GRCm39) I2531T probably damaging Het
Virma T A 4: 11,546,211 (GRCm39) I1683N possibly damaging Het
Vmn1r18 A T 6: 57,367,551 (GRCm39) M1K probably null Het
Vmn2r87 T C 10: 130,314,761 (GRCm39) N275S probably damaging Het
Vps13a T A 19: 16,701,066 (GRCm39) H701L probably benign Het
Vrk3 T A 7: 44,420,348 (GRCm39) probably null Het
Zfp993 T A 4: 146,742,098 (GRCm39) S141T possibly damaging Het
Other mutations in Cntrob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02975:Cntrob APN 11 69,210,199 (GRCm39) missense possibly damaging 0.66
IGL03173:Cntrob APN 11 69,200,853 (GRCm39) missense possibly damaging 0.90
groats UTSW 11 69,200,317 (GRCm39) nonsense probably null
BB005:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
BB015:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
R0270:Cntrob UTSW 11 69,202,167 (GRCm39) missense possibly damaging 0.66
R0501:Cntrob UTSW 11 69,213,694 (GRCm39) missense probably damaging 1.00
R1749:Cntrob UTSW 11 69,213,700 (GRCm39) missense probably damaging 0.99
R1775:Cntrob UTSW 11 69,211,693 (GRCm39) missense possibly damaging 0.90
R1900:Cntrob UTSW 11 69,198,880 (GRCm39) missense probably benign 0.27
R1967:Cntrob UTSW 11 69,211,789 (GRCm39) missense probably damaging 0.97
R2495:Cntrob UTSW 11 69,213,749 (GRCm39) missense probably damaging 0.96
R3121:Cntrob UTSW 11 69,213,526 (GRCm39) nonsense probably null
R3780:Cntrob UTSW 11 69,193,708 (GRCm39) missense probably damaging 0.97
R4449:Cntrob UTSW 11 69,196,375 (GRCm39) missense probably benign 0.29
R4696:Cntrob UTSW 11 69,211,714 (GRCm39) missense probably damaging 1.00
R4841:Cntrob UTSW 11 69,206,220 (GRCm39) missense possibly damaging 0.92
R4842:Cntrob UTSW 11 69,206,220 (GRCm39) missense possibly damaging 0.92
R4908:Cntrob UTSW 11 69,211,732 (GRCm39) missense probably damaging 0.97
R4982:Cntrob UTSW 11 69,202,188 (GRCm39) splice site probably null
R5168:Cntrob UTSW 11 69,190,816 (GRCm39) missense possibly damaging 0.66
R5187:Cntrob UTSW 11 69,212,717 (GRCm39) missense possibly damaging 0.62
R5307:Cntrob UTSW 11 69,205,576 (GRCm39) missense possibly damaging 0.66
R5473:Cntrob UTSW 11 69,213,579 (GRCm39) missense possibly damaging 0.81
R5903:Cntrob UTSW 11 69,200,201 (GRCm39) missense possibly damaging 0.83
R6643:Cntrob UTSW 11 69,202,248 (GRCm39) missense possibly damaging 0.46
R6742:Cntrob UTSW 11 69,213,749 (GRCm39) missense probably damaging 0.96
R6964:Cntrob UTSW 11 69,200,317 (GRCm39) nonsense probably null
R7020:Cntrob UTSW 11 69,193,918 (GRCm39) critical splice donor site probably null
R7928:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
R7946:Cntrob UTSW 11 69,206,047 (GRCm39) missense possibly damaging 0.82
R8348:Cntrob UTSW 11 69,190,679 (GRCm39) missense unknown
R8448:Cntrob UTSW 11 69,190,679 (GRCm39) missense unknown
R8539:Cntrob UTSW 11 69,211,652 (GRCm39) missense possibly damaging 0.94
R9259:Cntrob UTSW 11 69,211,665 (GRCm39) missense possibly damaging 0.81
R9415:Cntrob UTSW 11 69,193,741 (GRCm39) missense possibly damaging 0.66
R9553:Cntrob UTSW 11 69,205,679 (GRCm39) missense probably benign 0.00
R9626:Cntrob UTSW 11 69,202,167 (GRCm39) missense possibly damaging 0.66
R9628:Cntrob UTSW 11 69,213,782 (GRCm39) missense possibly damaging 0.66
R9801:Cntrob UTSW 11 69,212,233 (GRCm39) missense possibly damaging 0.82
Z1177:Cntrob UTSW 11 69,202,275 (GRCm39) missense possibly damaging 0.66
Z1186:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1186:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1187:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1187:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1188:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1188:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1189:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1189:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1190:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1190:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1191:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1191:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1192:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1192:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTGAGTCAACCCACACTGTG -3'
(R):5'- GTGTGACGTGGATCAGTAGC -3'

Sequencing Primer
(F):5'- CACACTGTGGGAAAATGTCTTCAG -3'
(R):5'- TGGATCAGTAGCCGGGG -3'
Posted On 2019-10-07