Incidental Mutation 'R7425:C1qbp'
ID576005
Institutional Source Beutler Lab
Gene Symbol C1qbp
Ensembl Gene ENSMUSG00000018446
Gene Namecomplement component 1, q subcomponent binding protein
SynonymsP32, D11Wsu182e, HABP1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7425 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location70977836-70983026 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 70978246 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000077612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018593] [ENSMUST00000078528] [ENSMUST00000108529] [ENSMUST00000167509] [ENSMUST00000169965] [ENSMUST00000171254] [ENSMUST00000178822]
Predicted Effect probably benign
Transcript: ENSMUST00000018593
SMART Domains Protein: ENSMUSP00000018593
Gene: ENSMUSG00000018449

DomainStartEndE-ValueType
Pfam:RPA_interact_N 8 47 1.7e-21 PFAM
Pfam:RPA_interact_M 59 127 1.1e-14 PFAM
Pfam:RPA_interact_C 136 217 2.8e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000078528
SMART Domains Protein: ENSMUSP00000077612
Gene: ENSMUSG00000018446

DomainStartEndE-ValueType
Pfam:MAM33 84 276 1.2e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108529
SMART Domains Protein: ENSMUSP00000104169
Gene: ENSMUSG00000018449

DomainStartEndE-ValueType
Pfam:RPA_interact_N 7 48 7.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167509
SMART Domains Protein: ENSMUSP00000127315
Gene: ENSMUSG00000018449

DomainStartEndE-ValueType
Pfam:RPA_interact_N 7 48 2.7e-23 PFAM
Pfam:RPA_interact_M 58 128 5.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169965
SMART Domains Protein: ENSMUSP00000128903
Gene: ENSMUSG00000018449

DomainStartEndE-ValueType
Pfam:RPA_interact_N 7 48 1e-23 PFAM
Pfam:RPA_interact_M 58 106 6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171254
SMART Domains Protein: ENSMUSP00000133243
Gene: ENSMUSG00000018449

DomainStartEndE-ValueType
Pfam:RPA_interact_N 7 48 1.1e-23 PFAM
Pfam:RPA_interact_M 58 107 3.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178822
SMART Domains Protein: ENSMUSP00000136592
Gene: ENSMUSG00000018449

DomainStartEndE-ValueType
Pfam:RPA_interact_N 7 48 2.7e-23 PFAM
Pfam:RPA_interact_M 58 128 5.3e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The human complement subcomponent C1q associates with C1r and C1s in order to yield the first component of the serum complement system. The protein encoded by this gene is known to bind to the globular heads of C1q molecules and inhibit C1 activation. This protein has also been identified as the p32 subunit of pre-mRNA splicing factor SF2, as well as a hyaluronic acid-binding protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality by E11.5 with poor development, small embryo size, pale and anemic organs, poor cellular proliferation and impaired mitochondrial electron transport chain function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,695 E215G probably benign Het
4932438A13Rik T A 3: 36,948,341 H1478Q probably benign Het
4932438A13Rik A T 3: 36,983,394 H2448L probably benign Het
Adam8 T A 7: 139,992,481 probably benign Het
Ankrd35 A G 3: 96,684,788 S797G not run Het
Anxa3 T A 5: 96,834,821 H259Q probably benign Het
Ap3d1 T A 10: 80,721,592 Q302L probably damaging Het
Atg2a T C 19: 6,255,652 V1294A probably benign Het
Atp13a5 G A 16: 29,297,460 Q613* probably null Het
Bmpr2 T G 1: 59,867,351 N534K probably benign Het
C1ql3 T G 2: 13,010,418 K144Q possibly damaging Het
C3 T C 17: 57,204,039 M1656V possibly damaging Het
Cand1 A T 10: 119,216,243 Y252N probably benign Het
Capn13 T C 17: 73,318,058 I632M probably benign Het
Catsperb A G 12: 101,591,498 E776G probably damaging Het
Ccnl1 A T 3: 65,948,758 V242D probably damaging Het
Cd68 T C 11: 69,665,112 D200G probably benign Het
Cela3a T C 4: 137,405,588 N118D probably benign Het
Celsr2 A G 3: 108,402,457 C1609R probably damaging Het
Cep85l G C 10: 53,301,570 Q458E probably damaging Het
Cnga1 T G 5: 72,609,525 E190D probably benign Het
Cntnap3 G A 13: 64,758,252 R847C probably damaging Het
Cntrob G A 11: 69,314,734 Q425* probably null Het
Commd9 G A 2: 101,899,900 W128* probably null Het
Csnk1a1 C T 18: 61,585,259 S352L unknown Het
Dact2 A G 17: 14,196,331 S536P probably damaging Het
Ddx25 A G 9: 35,554,586 I113T probably benign Het
Dscam T A 16: 96,629,398 D1630V probably damaging Het
Fndc7 A C 3: 108,876,659 F211L probably benign Het
Fryl T C 5: 73,104,748 T559A probably damaging Het
Hpx C A 7: 105,591,861 D402Y probably damaging Het
Ints13 A G 6: 146,574,700 probably null Het
Ipcef1 T C 10: 6,956,066 K76E probably damaging Het
Kcnb2 A C 1: 15,709,807 Q301P probably damaging Het
Lamp3 C T 16: 19,699,612 probably null Het
Lmod2 A T 6: 24,603,476 H150L probably benign Het
Lrch3 T C 16: 33,005,707 F718S probably damaging Het
Mms22l T C 4: 24,596,287 V1082A probably benign Het
Nbas G T 12: 13,469,880 V1598L probably damaging Het
Nrxn3 C T 12: 89,513,100 R671* probably null Het
Olfr1215 A T 2: 89,002,200 F29L Het
Olfr1441 A C 19: 12,422,840 H177P probably damaging Het
Olfr214 A T 6: 116,556,437 E4V possibly damaging Het
Olfr48 A G 2: 89,844,445 L176P probably damaging Het
Olfr671 A T 7: 104,975,061 L312* probably null Het
Pcdhga6 T A 18: 37,708,566 N446K probably damaging Het
Phlpp1 A T 1: 106,392,573 I1433F probably benign Het
Pla2g6 G A 15: 79,308,733 R245C probably damaging Het
Rgl3 G A 9: 21,976,827 Q464* probably null Het
Ryr2 T C 13: 11,705,644 D2706G probably benign Het
Sbf2 G A 7: 110,375,777 Q718* probably null Het
Sdad1 T C 5: 92,300,121 T252A probably benign Het
Sgk1 T C 10: 21,994,110 L16P probably damaging Het
Slc38a8 A G 8: 119,485,588 S339P possibly damaging Het
Slc44a4 T C 17: 34,921,691 S287P possibly damaging Het
Syne1 T C 10: 5,425,760 I111V probably damaging Het
Synm A C 7: 67,733,446 S1489R probably damaging Het
Tfb2m A G 1: 179,537,704 F232L probably benign Het
Traf3 A T 12: 111,260,661 K328* probably null Het
Trim38 C A 13: 23,788,382 Q229K probably benign Het
Vcan A G 13: 89,689,832 I2531T probably damaging Het
Virma T A 4: 11,546,211 I1683N possibly damaging Het
Vmn1r18 A T 6: 57,390,566 M1K probably null Het
Vmn2r87 T C 10: 130,478,892 N275S probably damaging Het
Vps13a T A 19: 16,723,702 H701L probably benign Het
Vrk3 T A 7: 44,770,924 probably null Het
Zfp993 T A 4: 146,657,641 S141T possibly damaging Het
Other mutations in C1qbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1694:C1qbp UTSW 11 70978247 splice site probably null
R2100:C1qbp UTSW 11 70978102 missense probably benign 0.27
R4529:C1qbp UTSW 11 70978724 missense probably benign
R4790:C1qbp UTSW 11 70980030 nonsense probably null
R4816:C1qbp UTSW 11 70982364 unclassified probably benign
R5702:C1qbp UTSW 11 70978744 missense probably benign 0.00
R5886:C1qbp UTSW 11 70982182 missense probably benign 0.00
R7425:C1qbp UTSW 11 70978247 splice site probably null
R7604:C1qbp UTSW 11 70978772 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGCAGTCTCTGAGTTCTAC -3'
(R):5'- CTCTGAGTGGAGGGATACAAAC -3'

Sequencing Primer
(F):5'- GAGTTCTACTGGTTCTTGACAAAGC -3'
(R):5'- TGGAGGGATACAAACTATACACTC -3'
Posted On2019-10-07