Incidental Mutation 'R7425:Nbas'
ID576007
Institutional Source Beutler Lab
Gene Symbol Nbas
Ensembl Gene ENSMUSG00000020576
Gene Nameneuroblastoma amplified sequence
Synonyms4933425L03Rik
MMRRC Submission
Accession Numbers

Genbank: NM_027706.1; Ensembl: ENSMUST00000042953

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7425 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location13269133-13583811 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 13469880 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 1598 (V1598L)
Ref Sequence ENSEMBL: ENSMUSP00000036082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042953]
Predicted Effect probably damaging
Transcript: ENSMUST00000042953
AA Change: V1598L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036082
Gene: ENSMUSG00000020576
AA Change: V1598L

DomainStartEndE-ValueType
Pfam:Nbas_N 89 370 4.7e-171 PFAM
low complexity region 463 475 N/A INTRINSIC
low complexity region 653 667 N/A INTRINSIC
Pfam:Sec39 725 1375 3.8e-34 PFAM
low complexity region 1392 1404 N/A INTRINSIC
low complexity region 1549 1566 N/A INTRINSIC
low complexity region 2226 2252 N/A INTRINSIC
low complexity region 2275 2285 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two leucine zipper domains, a ribosomal protein S14 signature domain and a Sec39 like domain. The protein is thought to be involved in Golgi-to-ER transport. Mutations in this gene are associated with short stature, optic nerve atrophy, and Pelger-Huet anomaly. [provided by RefSeq, Oct 2012]
Allele List at MGI

All alleles(10) : Targeted, other(2) Gene trapped(8)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,695 E215G probably benign Het
4932438A13Rik T A 3: 36,948,341 H1478Q probably benign Het
4932438A13Rik A T 3: 36,983,394 H2448L probably benign Het
Adam8 T A 7: 139,992,481 probably benign Het
Ankrd35 A G 3: 96,684,788 S797G not run Het
Anxa3 T A 5: 96,834,821 H259Q probably benign Het
Ap3d1 T A 10: 80,721,592 Q302L probably damaging Het
Atg2a T C 19: 6,255,652 V1294A probably benign Het
Atp13a5 G A 16: 29,297,460 Q613* probably null Het
Bmpr2 T G 1: 59,867,351 N534K probably benign Het
C1qbp T C 11: 70,978,246 probably null Het
C1qbp G T 11: 70,978,247 probably null Het
C1ql3 T G 2: 13,010,418 K144Q possibly damaging Het
C3 T C 17: 57,204,039 M1656V possibly damaging Het
Cand1 A T 10: 119,216,243 Y252N probably benign Het
Capn13 T C 17: 73,318,058 I632M probably benign Het
Catsperb A G 12: 101,591,498 E776G probably damaging Het
Ccnl1 A T 3: 65,948,758 V242D probably damaging Het
Cd68 T C 11: 69,665,112 D200G probably benign Het
Cela3a T C 4: 137,405,588 N118D probably benign Het
Celsr2 A G 3: 108,402,457 C1609R probably damaging Het
Cep85l G C 10: 53,301,570 Q458E probably damaging Het
Cnga1 T G 5: 72,609,525 E190D probably benign Het
Cntnap3 G A 13: 64,758,252 R847C probably damaging Het
Cntrob G A 11: 69,314,734 Q425* probably null Het
Commd9 G A 2: 101,899,900 W128* probably null Het
Csnk1a1 C T 18: 61,585,259 S352L unknown Het
Dact2 A G 17: 14,196,331 S536P probably damaging Het
Ddx25 A G 9: 35,554,586 I113T probably benign Het
Dscam T A 16: 96,629,398 D1630V probably damaging Het
Fndc7 A C 3: 108,876,659 F211L probably benign Het
Fryl T C 5: 73,104,748 T559A probably damaging Het
Hpx C A 7: 105,591,861 D402Y probably damaging Het
Ints13 A G 6: 146,574,700 probably null Het
Ipcef1 T C 10: 6,956,066 K76E probably damaging Het
Kcnb2 A C 1: 15,709,807 Q301P probably damaging Het
Lamp3 C T 16: 19,699,612 probably null Het
Lmod2 A T 6: 24,603,476 H150L probably benign Het
Lrch3 T C 16: 33,005,707 F718S probably damaging Het
Mms22l T C 4: 24,596,287 V1082A probably benign Het
Nrxn3 C T 12: 89,513,100 R671* probably null Het
Olfr1215 A T 2: 89,002,200 F29L Het
Olfr1441 A C 19: 12,422,840 H177P probably damaging Het
Olfr214 A T 6: 116,556,437 E4V possibly damaging Het
Olfr48 A G 2: 89,844,445 L176P probably damaging Het
Olfr671 A T 7: 104,975,061 L312* probably null Het
Pcdhga6 T A 18: 37,708,566 N446K probably damaging Het
Phlpp1 A T 1: 106,392,573 I1433F probably benign Het
Pla2g6 G A 15: 79,308,733 R245C probably damaging Het
Rgl3 G A 9: 21,976,827 Q464* probably null Het
Ryr2 T C 13: 11,705,644 D2706G probably benign Het
Sbf2 G A 7: 110,375,777 Q718* probably null Het
Sdad1 T C 5: 92,300,121 T252A probably benign Het
Sgk1 T C 10: 21,994,110 L16P probably damaging Het
Slc38a8 A G 8: 119,485,588 S339P possibly damaging Het
Slc44a4 T C 17: 34,921,691 S287P possibly damaging Het
Syne1 T C 10: 5,425,760 I111V probably damaging Het
Synm A C 7: 67,733,446 S1489R probably damaging Het
Tfb2m A G 1: 179,537,704 F232L probably benign Het
Traf3 A T 12: 111,260,661 K328* probably null Het
Trim38 C A 13: 23,788,382 Q229K probably benign Het
Vcan A G 13: 89,689,832 I2531T probably damaging Het
Virma T A 4: 11,546,211 I1683N possibly damaging Het
Vmn1r18 A T 6: 57,390,566 M1K probably null Het
Vmn2r87 T C 10: 130,478,892 N275S probably damaging Het
Vps13a T A 19: 16,723,702 H701L probably benign Het
Vrk3 T A 7: 44,770,924 probably null Het
Zfp993 T A 4: 146,657,641 S141T possibly damaging Het
Other mutations in Nbas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Nbas APN 12 13453075 missense probably benign 0.19
IGL00712:Nbas APN 12 13362625 splice site probably benign
IGL00808:Nbas APN 12 13566120 splice site probably benign
IGL00915:Nbas APN 12 13374752 nonsense probably null
IGL00923:Nbas APN 12 13336284 missense possibly damaging 0.46
IGL01152:Nbas APN 12 13360958 missense probably damaging 1.00
IGL01633:Nbas APN 12 13483897 missense probably damaging 1.00
IGL01672:Nbas APN 12 13379649 missense possibly damaging 0.63
IGL01799:Nbas APN 12 13324400 splice site probably benign
IGL01812:Nbas APN 12 13453503 missense probably damaging 1.00
IGL01934:Nbas APN 12 13289879 splice site probably benign
IGL02093:Nbas APN 12 13560962 missense probably benign 0.00
IGL02115:Nbas APN 12 13317692 splice site probably benign
IGL02175:Nbas APN 12 13566259 critical splice donor site probably null
IGL02268:Nbas APN 12 13405397 missense possibly damaging 0.94
IGL02483:Nbas APN 12 13324294 missense probably damaging 1.00
IGL02539:Nbas APN 12 13272703 splice site probably benign
IGL02557:Nbas APN 12 13361028 missense probably damaging 1.00
IGL02815:Nbas APN 12 13310266 missense probably damaging 1.00
IGL02951:Nbas APN 12 13362541 missense probably benign
IGL03131:Nbas APN 12 13279416 missense probably benign 0.03
IGL03214:Nbas APN 12 13331110 splice site probably benign
IGL03308:Nbas APN 12 13324348 missense possibly damaging 0.93
IGL03368:Nbas APN 12 13328451 missense probably benign 0.08
IGL03372:Nbas APN 12 13534472 missense probably damaging 1.00
IGL03391:Nbas APN 12 13483749 missense probably benign 0.28
medvedev UTSW 12 13534577 critical splice donor site probably null
oligarchs UTSW 12 13520750 missense possibly damaging 0.75
putin UTSW 12 13321755 missense probably damaging 1.00
1mM(1):Nbas UTSW 12 13288728 missense probably damaging 1.00
R0057:Nbas UTSW 12 13390957 missense probably benign 0.00
R0076:Nbas UTSW 12 13324336 missense probably damaging 1.00
R0153:Nbas UTSW 12 13273876 splice site probably benign
R0371:Nbas UTSW 12 13331095 missense probably damaging 0.97
R0449:Nbas UTSW 12 13519108 missense probably benign 0.18
R0791:Nbas UTSW 12 13482633 missense probably benign 0.28
R0931:Nbas UTSW 12 13331114 splice site probably benign
R1236:Nbas UTSW 12 13269241 missense probably damaging 1.00
R1371:Nbas UTSW 12 13482378 splice site probably benign
R1567:Nbas UTSW 12 13285278 missense possibly damaging 0.70
R1587:Nbas UTSW 12 13558685 missense probably benign
R1719:Nbas UTSW 12 13560977 critical splice donor site probably null
R1747:Nbas UTSW 12 13335898 missense probably benign 0.00
R1777:Nbas UTSW 12 13513562 missense probably benign 0.16
R1848:Nbas UTSW 12 13413597 missense probably damaging 0.97
R1856:Nbas UTSW 12 13474229 missense possibly damaging 0.56
R1891:Nbas UTSW 12 13390972 missense possibly damaging 0.92
R1911:Nbas UTSW 12 13566144 missense probably benign
R1912:Nbas UTSW 12 13566144 missense probably benign
R2006:Nbas UTSW 12 13414741 intron probably null
R2054:Nbas UTSW 12 13474206 missense probably benign 0.36
R2065:Nbas UTSW 12 13566157 missense probably damaging 1.00
R2089:Nbas UTSW 12 13361045 missense probably benign 0.03
R2091:Nbas UTSW 12 13361045 missense probably benign 0.03
R2091:Nbas UTSW 12 13361045 missense probably benign 0.03
R2156:Nbas UTSW 12 13441509 missense probably damaging 1.00
R2164:Nbas UTSW 12 13330646 missense possibly damaging 0.74
R2339:Nbas UTSW 12 13362592 missense probably benign 0.12
R2398:Nbas UTSW 12 13432945 missense probably damaging 0.99
R3806:Nbas UTSW 12 13482504 missense probably damaging 1.00
R3855:Nbas UTSW 12 13279414 missense possibly damaging 0.50
R4019:Nbas UTSW 12 13482519 missense probably damaging 1.00
R4083:Nbas UTSW 12 13474191 missense probably damaging 0.96
R4201:Nbas UTSW 12 13374826 missense probably benign 0.00
R4231:Nbas UTSW 12 13393343 missense probably damaging 0.98
R4552:Nbas UTSW 12 13335937 critical splice donor site probably null
R4560:Nbas UTSW 12 13583527 missense probably benign 0.00
R4728:Nbas UTSW 12 13288739 missense probably damaging 0.98
R4752:Nbas UTSW 12 13482537 missense possibly damaging 0.92
R4832:Nbas UTSW 12 13483739 missense probably benign 0.00
R4874:Nbas UTSW 12 13321755 missense probably damaging 1.00
R4988:Nbas UTSW 12 13408265 missense probably benign 0.45
R5020:Nbas UTSW 12 13374712 missense probably damaging 0.99
R5079:Nbas UTSW 12 13374711 missense probably damaging 1.00
R5129:Nbas UTSW 12 13390960 missense probably damaging 1.00
R5239:Nbas UTSW 12 13441518 missense probably benign 0.31
R5299:Nbas UTSW 12 13441925 nonsense probably null
R5351:Nbas UTSW 12 13560849 missense probably damaging 1.00
R5389:Nbas UTSW 12 13534577 critical splice donor site probably null
R5436:Nbas UTSW 12 13374811 missense probably damaging 1.00
R5654:Nbas UTSW 12 13583475 missense probably damaging 1.00
R5690:Nbas UTSW 12 13336284 missense probably damaging 1.00
R5842:Nbas UTSW 12 13269266 critical splice donor site probably null
R5959:Nbas UTSW 12 13288801 missense probably damaging 0.99
R5982:Nbas UTSW 12 13393430 missense probably benign 0.00
R6238:Nbas UTSW 12 13482595 missense probably benign
R6270:Nbas UTSW 12 13324293 missense probably damaging 1.00
R6363:Nbas UTSW 12 13482576 missense probably benign
R6424:Nbas UTSW 12 13415733 critical splice donor site probably null
R6458:Nbas UTSW 12 13288749 missense probably damaging 1.00
R6526:Nbas UTSW 12 13405425 missense probably damaging 1.00
R6654:Nbas UTSW 12 13483874 nonsense probably null
R7085:Nbas UTSW 12 13285258 missense probably damaging 1.00
R7179:Nbas UTSW 12 13405397 missense possibly damaging 0.94
R7197:Nbas UTSW 12 13520750 missense possibly damaging 0.75
R7378:Nbas UTSW 12 13274219 missense probably damaging 1.00
R7393:Nbas UTSW 12 13393492 missense probably damaging 1.00
R7446:Nbas UTSW 12 13393498 missense probably benign 0.02
R7481:Nbas UTSW 12 13356959 missense probably damaging 0.97
R7535:Nbas UTSW 12 13279389 missense probably damaging 0.97
R7626:Nbas UTSW 12 13558660 missense probably benign 0.00
R7678:Nbas UTSW 12 13415661 missense probably damaging 0.97
R7912:Nbas UTSW 12 13405457 missense possibly damaging 0.91
R7993:Nbas UTSW 12 13405457 missense possibly damaging 0.91
RF013:Nbas UTSW 12 13279408 missense possibly damaging 0.54
T0722:Nbas UTSW 12 13352808 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAGTGCTACTTCCGACTTGGC -3'
(R):5'- AAGTGACCCCTTACTCTGCC -3'

Sequencing Primer
(F):5'- ACTTCCGACTTGGCTTTTAGG -3'
(R):5'- AGGCCCAGGATGGTTTCTC -3'
Posted On2019-10-07