Incidental Mutation 'R7425:Traf3'
ID576010
Institutional Source Beutler Lab
Gene Symbol Traf3
Ensembl Gene ENSMUSG00000021277
Gene NameTNF receptor-associated factor 3
SynonymsLAP1, CRAF1, CD40bp, CAP-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7425 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location111166370-111267153 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 111260661 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 328 (K328*)
Ref Sequence ENSEMBL: ENSMUSP00000021706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021706] [ENSMUST00000060274] [ENSMUST00000117269]
PDB Structure
Crystal structure of TRAF3/Cardif [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000021706
AA Change: K328*
SMART Domains Protein: ENSMUSP00000021706
Gene: ENSMUSG00000021277
AA Change: K328*

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 4.6e-18 PFAM
Pfam:zf-TRAF 191 250 9.9e-14 PFAM
coiled coil region 298 337 N/A INTRINSIC
MATH 419 542 5.69e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000060274
AA Change: K303*
SMART Domains Protein: ENSMUSP00000058361
Gene: ENSMUSG00000021277
AA Change: K303*

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 1.5e-17 PFAM
coiled coil region 273 312 N/A INTRINSIC
MATH 394 517 5.69e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000117269
AA Change: K303*
SMART Domains Protein: ENSMUSP00000112517
Gene: ENSMUSG00000021277
AA Change: K303*

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 1.5e-17 PFAM
coiled coil region 273 312 N/A INTRINSIC
MATH 394 517 5.69e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from, members of the TNF receptor (TNFR) superfamily. This protein participates in the signal transduction of CD40, a TNFR family member important for the activation of the immune response. This protein is found to be a critical component of the lymphotoxin-beta receptor (LTbetaR) signaling complex, which induces NF-kappaB activation and cell death initiated by LTbeta ligation. Epstein-Barr virus encoded latent infection membrane protein-1 (LMP1) can interact with this and several other members of the TRAF family, which may be essential for the oncogenic effects of LMP1. Several alternatively spliced transcript variants encoding three distinct isoforms have been reported. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous mutation of this gene results in progressive runting, hypoglycemia, and depletion of peripheral white blood cells, leading to death by 10 days of age. Immune responses to T-dependent antigen are impaired in lethally irradiated mice reconstituted with mutant cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,695 E215G probably benign Het
4932438A13Rik T A 3: 36,948,341 H1478Q probably benign Het
4932438A13Rik A T 3: 36,983,394 H2448L probably benign Het
Adam8 T A 7: 139,992,481 probably benign Het
Ankrd35 A G 3: 96,684,788 S797G not run Het
Anxa3 T A 5: 96,834,821 H259Q probably benign Het
Ap3d1 T A 10: 80,721,592 Q302L probably damaging Het
Atg2a T C 19: 6,255,652 V1294A probably benign Het
Atp13a5 G A 16: 29,297,460 Q613* probably null Het
Bmpr2 T G 1: 59,867,351 N534K probably benign Het
C1qbp T C 11: 70,978,246 probably null Het
C1qbp G T 11: 70,978,247 probably null Het
C1ql3 T G 2: 13,010,418 K144Q possibly damaging Het
C3 T C 17: 57,204,039 M1656V possibly damaging Het
Cand1 A T 10: 119,216,243 Y252N probably benign Het
Capn13 T C 17: 73,318,058 I632M probably benign Het
Catsperb A G 12: 101,591,498 E776G probably damaging Het
Ccnl1 A T 3: 65,948,758 V242D probably damaging Het
Cd68 T C 11: 69,665,112 D200G probably benign Het
Cela3a T C 4: 137,405,588 N118D probably benign Het
Celsr2 A G 3: 108,402,457 C1609R probably damaging Het
Cep85l G C 10: 53,301,570 Q458E probably damaging Het
Cnga1 T G 5: 72,609,525 E190D probably benign Het
Cntnap3 G A 13: 64,758,252 R847C probably damaging Het
Cntrob G A 11: 69,314,734 Q425* probably null Het
Commd9 G A 2: 101,899,900 W128* probably null Het
Csnk1a1 C T 18: 61,585,259 S352L unknown Het
Dact2 A G 17: 14,196,331 S536P probably damaging Het
Ddx25 A G 9: 35,554,586 I113T probably benign Het
Dscam T A 16: 96,629,398 D1630V probably damaging Het
Fndc7 A C 3: 108,876,659 F211L probably benign Het
Fryl T C 5: 73,104,748 T559A probably damaging Het
Hpx C A 7: 105,591,861 D402Y probably damaging Het
Ints13 A G 6: 146,574,700 probably null Het
Ipcef1 T C 10: 6,956,066 K76E probably damaging Het
Kcnb2 A C 1: 15,709,807 Q301P probably damaging Het
Lamp3 C T 16: 19,699,612 probably null Het
Lmod2 A T 6: 24,603,476 H150L probably benign Het
Lrch3 T C 16: 33,005,707 F718S probably damaging Het
Mms22l T C 4: 24,596,287 V1082A probably benign Het
Nbas G T 12: 13,469,880 V1598L probably damaging Het
Nrxn3 C T 12: 89,513,100 R671* probably null Het
Olfr1215 A T 2: 89,002,200 F29L Het
Olfr1441 A C 19: 12,422,840 H177P probably damaging Het
Olfr214 A T 6: 116,556,437 E4V possibly damaging Het
Olfr48 A G 2: 89,844,445 L176P probably damaging Het
Olfr671 A T 7: 104,975,061 L312* probably null Het
Pcdhga6 T A 18: 37,708,566 N446K probably damaging Het
Phlpp1 A T 1: 106,392,573 I1433F probably benign Het
Pla2g6 G A 15: 79,308,733 R245C probably damaging Het
Rgl3 G A 9: 21,976,827 Q464* probably null Het
Ryr2 T C 13: 11,705,644 D2706G probably benign Het
Sbf2 G A 7: 110,375,777 Q718* probably null Het
Sdad1 T C 5: 92,300,121 T252A probably benign Het
Sgk1 T C 10: 21,994,110 L16P probably damaging Het
Slc38a8 A G 8: 119,485,588 S339P possibly damaging Het
Slc44a4 T C 17: 34,921,691 S287P possibly damaging Het
Syne1 T C 10: 5,425,760 I111V probably damaging Het
Synm A C 7: 67,733,446 S1489R probably damaging Het
Tfb2m A G 1: 179,537,704 F232L probably benign Het
Trim38 C A 13: 23,788,382 Q229K probably benign Het
Vcan A G 13: 89,689,832 I2531T probably damaging Het
Virma T A 4: 11,546,211 I1683N possibly damaging Het
Vmn1r18 A T 6: 57,390,566 M1K probably null Het
Vmn2r87 T C 10: 130,478,892 N275S probably damaging Het
Vps13a T A 19: 16,723,702 H701L probably benign Het
Vrk3 T A 7: 44,770,924 probably null Het
Zfp993 T A 4: 146,657,641 S141T possibly damaging Het
Other mutations in Traf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Traf3 APN 12 111239067 missense probably damaging 0.99
IGL02015:Traf3 APN 12 111252740 missense probably benign
IGL02318:Traf3 APN 12 111237597 missense probably benign
IGL02429:Traf3 APN 12 111243465 missense probably benign 0.19
IGL03088:Traf3 APN 12 111261843 missense probably damaging 0.99
bananasplit UTSW 12 111262036 missense probably damaging 1.00
Han UTSW 12 111261576 missense probably damaging 1.00
Hulk UTSW 12 111261576 missense probably damaging 1.00
sundae UTSW 12 111255224 missense possibly damaging 0.80
R0023:Traf3 UTSW 12 111243478 nonsense probably null
R0143:Traf3 UTSW 12 111261576 missense probably damaging 1.00
R1453:Traf3 UTSW 12 111255323 missense probably damaging 0.96
R1507:Traf3 UTSW 12 111260760 missense probably benign 0.30
R1651:Traf3 UTSW 12 111262036 missense probably damaging 1.00
R1714:Traf3 UTSW 12 111242473 missense probably benign 0.01
R1996:Traf3 UTSW 12 111260661 missense probably benign 0.21
R1997:Traf3 UTSW 12 111260661 missense probably benign 0.21
R3946:Traf3 UTSW 12 111255245 missense possibly damaging 0.91
R4477:Traf3 UTSW 12 111248602 missense probably benign 0.00
R4645:Traf3 UTSW 12 111261966 missense probably damaging 1.00
R4723:Traf3 UTSW 12 111262036 missense probably damaging 1.00
R4820:Traf3 UTSW 12 111260770 missense possibly damaging 0.96
R5123:Traf3 UTSW 12 111243518 missense possibly damaging 0.52
R5775:Traf3 UTSW 12 111252728 missense possibly damaging 0.91
R5825:Traf3 UTSW 12 111255361 missense probably benign 0.03
R5912:Traf3 UTSW 12 111255349 missense probably benign 0.01
R6611:Traf3 UTSW 12 111237640 missense possibly damaging 0.76
R6933:Traf3 UTSW 12 111255224 missense possibly damaging 0.80
R7389:Traf3 UTSW 12 111237753 missense probably damaging 1.00
R8512:Traf3 UTSW 12 111261992 missense probably benign 0.06
X0052:Traf3 UTSW 12 111252736 missense probably benign 0.41
Z1176:Traf3 UTSW 12 111261836 missense probably damaging 1.00
Z1177:Traf3 UTSW 12 111261492 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTTCCTATCCCCAGAGACTC -3'
(R):5'- TGAAAACTGCCCCTACTAGAGGC -3'

Sequencing Primer
(F):5'- TATCCCCAGAGACTCCCAGGAG -3'
(R):5'- TACTAGAGGCCTCCCAGCATG -3'
Posted On2019-10-07