Incidental Mutation 'R7425:Cntnap3'
ID576013
Institutional Source Beutler Lab
Gene Symbol Cntnap3
Ensembl Gene ENSMUSG00000033063
Gene Namecontactin associated protein-like 3
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7425 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location64736182-64903955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 64758252 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 847 (R847C)
Ref Sequence ENSEMBL: ENSMUSP00000089140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091554]
Predicted Effect probably damaging
Transcript: ENSMUST00000091554
AA Change: R847C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: R847C

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FA58C 33 180 4.88e-17 SMART
LamG 207 345 1.47e-11 SMART
LamG 394 525 1.43e-23 SMART
EGF 553 587 1.33e-1 SMART
FBG 590 775 6.76e-1 SMART
LamG 815 942 1.89e-32 SMART
EGF_like 963 999 6.28e1 SMART
LamG 1040 1178 9.46e-15 SMART
transmembrane domain 1245 1267 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,695 E215G probably benign Het
4932438A13Rik T A 3: 36,948,341 H1478Q probably benign Het
4932438A13Rik A T 3: 36,983,394 H2448L probably benign Het
Adam8 T A 7: 139,992,481 probably benign Het
Ankrd35 A G 3: 96,684,788 S797G not run Het
Anxa3 T A 5: 96,834,821 H259Q probably benign Het
Ap3d1 T A 10: 80,721,592 Q302L probably damaging Het
Atg2a T C 19: 6,255,652 V1294A probably benign Het
Atp13a5 G A 16: 29,297,460 Q613* probably null Het
Bmpr2 T G 1: 59,867,351 N534K probably benign Het
C1qbp T C 11: 70,978,246 probably null Het
C1qbp G T 11: 70,978,247 probably null Het
C1ql3 T G 2: 13,010,418 K144Q possibly damaging Het
C3 T C 17: 57,204,039 M1656V possibly damaging Het
Cand1 A T 10: 119,216,243 Y252N probably benign Het
Capn13 T C 17: 73,318,058 I632M probably benign Het
Catsperb A G 12: 101,591,498 E776G probably damaging Het
Ccnl1 A T 3: 65,948,758 V242D probably damaging Het
Cd68 T C 11: 69,665,112 D200G probably benign Het
Cela3a T C 4: 137,405,588 N118D probably benign Het
Celsr2 A G 3: 108,402,457 C1609R probably damaging Het
Cep85l G C 10: 53,301,570 Q458E probably damaging Het
Cnga1 T G 5: 72,609,525 E190D probably benign Het
Cntrob G A 11: 69,314,734 Q425* probably null Het
Commd9 G A 2: 101,899,900 W128* probably null Het
Csnk1a1 C T 18: 61,585,259 S352L unknown Het
Dact2 A G 17: 14,196,331 S536P probably damaging Het
Ddx25 A G 9: 35,554,586 I113T probably benign Het
Dscam T A 16: 96,629,398 D1630V probably damaging Het
Fndc7 A C 3: 108,876,659 F211L probably benign Het
Fryl T C 5: 73,104,748 T559A probably damaging Het
Hpx C A 7: 105,591,861 D402Y probably damaging Het
Ints13 A G 6: 146,574,700 probably null Het
Ipcef1 T C 10: 6,956,066 K76E probably damaging Het
Kcnb2 A C 1: 15,709,807 Q301P probably damaging Het
Lamp3 C T 16: 19,699,612 probably null Het
Lmod2 A T 6: 24,603,476 H150L probably benign Het
Lrch3 T C 16: 33,005,707 F718S probably damaging Het
Mms22l T C 4: 24,596,287 V1082A probably benign Het
Nbas G T 12: 13,469,880 V1598L probably damaging Het
Nrxn3 C T 12: 89,513,100 R671* probably null Het
Olfr1215 A T 2: 89,002,200 F29L Het
Olfr1441 A C 19: 12,422,840 H177P probably damaging Het
Olfr214 A T 6: 116,556,437 E4V possibly damaging Het
Olfr48 A G 2: 89,844,445 L176P probably damaging Het
Olfr671 A T 7: 104,975,061 L312* probably null Het
Pcdhga6 T A 18: 37,708,566 N446K probably damaging Het
Phlpp1 A T 1: 106,392,573 I1433F probably benign Het
Pla2g6 G A 15: 79,308,733 R245C probably damaging Het
Rgl3 G A 9: 21,976,827 Q464* probably null Het
Ryr2 T C 13: 11,705,644 D2706G probably benign Het
Sbf2 G A 7: 110,375,777 Q718* probably null Het
Sdad1 T C 5: 92,300,121 T252A probably benign Het
Sgk1 T C 10: 21,994,110 L16P probably damaging Het
Slc38a8 A G 8: 119,485,588 S339P possibly damaging Het
Slc44a4 T C 17: 34,921,691 S287P possibly damaging Het
Syne1 T C 10: 5,425,760 I111V probably damaging Het
Synm A C 7: 67,733,446 S1489R probably damaging Het
Tfb2m A G 1: 179,537,704 F232L probably benign Het
Traf3 A T 12: 111,260,661 K328* probably null Het
Trim38 C A 13: 23,788,382 Q229K probably benign Het
Vcan A G 13: 89,689,832 I2531T probably damaging Het
Virma T A 4: 11,546,211 I1683N possibly damaging Het
Vmn1r18 A T 6: 57,390,566 M1K probably null Het
Vmn2r87 T C 10: 130,478,892 N275S probably damaging Het
Vps13a T A 19: 16,723,702 H701L probably benign Het
Vrk3 T A 7: 44,770,924 probably null Het
Zfp993 T A 4: 146,657,641 S141T possibly damaging Het
Other mutations in Cntnap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cntnap3 APN 13 64772731 missense probably damaging 1.00
IGL00782:Cntnap3 APN 13 64745805 splice site probably benign
IGL00976:Cntnap3 APN 13 64794352 missense probably damaging 1.00
IGL01319:Cntnap3 APN 13 64787837 missense probably damaging 1.00
IGL01610:Cntnap3 APN 13 64757301 missense probably damaging 0.98
IGL01861:Cntnap3 APN 13 64799108 missense probably damaging 1.00
IGL02127:Cntnap3 APN 13 64799064 splice site probably benign
IGL02133:Cntnap3 APN 13 64751673 splice site probably benign
IGL02251:Cntnap3 APN 13 64762036 missense probably damaging 1.00
IGL02272:Cntnap3 APN 13 64757411 missense probably damaging 1.00
IGL02370:Cntnap3 APN 13 64751751 missense probably benign
IGL02456:Cntnap3 APN 13 64799058 splice site probably benign
IGL02589:Cntnap3 APN 13 64792430 missense probably benign 0.08
IGL02695:Cntnap3 APN 13 64772132 missense probably benign 0.01
IGL02850:Cntnap3 APN 13 64757409 missense probably damaging 1.00
IGL03038:Cntnap3 APN 13 64741025 missense possibly damaging 0.50
IGL03188:Cntnap3 APN 13 64781745 missense probably damaging 0.97
IGL03327:Cntnap3 APN 13 64887768 nonsense probably null
PIT4480001:Cntnap3 UTSW 13 64757210 missense probably damaging 1.00
R0309:Cntnap3 UTSW 13 64757436 splice site probably benign
R0422:Cntnap3 UTSW 13 64757285 missense probably damaging 0.96
R0463:Cntnap3 UTSW 13 64778876 missense probably damaging 1.00
R0491:Cntnap3 UTSW 13 64762045 missense probably benign 0.01
R0499:Cntnap3 UTSW 13 64858678 missense probably benign 0.33
R0550:Cntnap3 UTSW 13 64762000 missense possibly damaging 0.86
R0613:Cntnap3 UTSW 13 64758414 missense probably damaging 1.00
R0666:Cntnap3 UTSW 13 64757397 missense probably damaging 1.00
R0840:Cntnap3 UTSW 13 64787910 missense possibly damaging 0.94
R1577:Cntnap3 UTSW 13 64758290 missense probably damaging 1.00
R1716:Cntnap3 UTSW 13 64762002 missense probably damaging 1.00
R1732:Cntnap3 UTSW 13 64740812 critical splice donor site probably null
R1739:Cntnap3 UTSW 13 64740592 missense probably benign 0.17
R1905:Cntnap3 UTSW 13 64903764 missense probably benign 0.04
R1988:Cntnap3 UTSW 13 64758390 missense probably damaging 1.00
R2086:Cntnap3 UTSW 13 64794262 missense possibly damaging 0.76
R3732:Cntnap3 UTSW 13 64740999 missense possibly damaging 0.73
R3808:Cntnap3 UTSW 13 64781804 missense probably damaging 0.96
R3809:Cntnap3 UTSW 13 64781804 missense probably damaging 0.96
R4384:Cntnap3 UTSW 13 64748460 missense probably damaging 1.00
R4433:Cntnap3 UTSW 13 64778853 missense possibly damaging 0.92
R4631:Cntnap3 UTSW 13 64778883 missense probably benign 0.04
R4645:Cntnap3 UTSW 13 64778788 critical splice donor site probably null
R4702:Cntnap3 UTSW 13 64778862 missense probably benign 0.17
R4876:Cntnap3 UTSW 13 64787706 missense probably benign 0.00
R4994:Cntnap3 UTSW 13 64761984 missense possibly damaging 0.55
R5043:Cntnap3 UTSW 13 64794348 missense probably damaging 1.00
R5214:Cntnap3 UTSW 13 64762010 missense probably damaging 1.00
R5403:Cntnap3 UTSW 13 64761978 missense possibly damaging 0.90
R5571:Cntnap3 UTSW 13 64903758 missense probably damaging 0.98
R5587:Cntnap3 UTSW 13 64746738 missense probably damaging 1.00
R5695:Cntnap3 UTSW 13 64787955 missense probably damaging 0.99
R5834:Cntnap3 UTSW 13 64748577 missense probably benign 0.07
R5892:Cntnap3 UTSW 13 64799180 missense probably damaging 1.00
R5950:Cntnap3 UTSW 13 64787769 missense probably damaging 1.00
R6526:Cntnap3 UTSW 13 64781888 missense possibly damaging 0.96
R6954:Cntnap3 UTSW 13 64748559 missense probably benign 0.00
R7138:Cntnap3 UTSW 13 64781725 critical splice donor site probably null
R7355:Cntnap3 UTSW 13 64771962 missense probably benign
R7521:Cntnap3 UTSW 13 64772001 missense probably benign 0.22
R7719:Cntnap3 UTSW 13 64772777 nonsense probably null
R7810:Cntnap3 UTSW 13 64793308 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GTATGTGCCCATGACTAGAATAAC -3'
(R):5'- ACCAGAGTCATTTTGGAACTCAG -3'

Sequencing Primer
(F):5'- GTGCCCATGACTAGAATAACAAATAG -3'
(R):5'- AGAGTCATTTTGGAACTCAGCTTCC -3'
Posted On2019-10-07