Mutagenetix > Incidental Mutation

Incidental Mutation 'R7425:Cntnap3'

576013

Institutional Source

Beutler Lab

Gene Symbol

Cntnap3

Ensembl Gene

ENSMUSG00000033063

Gene Name

contactin associated protein-like 3

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.060) question?

Stock #

R7425 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

64736182-64903955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 64758252 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 847 (R847C)

Ref Sequence

ENSEMBL: ENSMUSP00000089140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091554]

AlphaFold

E9PY62

Predicted Effect

probably damaging
Transcript: ENSMUST00000091554
AA Change: R847C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: R847C

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FA58C	33	180	4.88e-17	SMART
LamG	207	345	1.47e-11	SMART
LamG	394	525	1.43e-23	SMART
EGF	553	587	1.33e-1	SMART
FBG	590	775	6.76e-1	SMART
LamG	815	942	1.89e-32	SMART
EGF_like	963	999	6.28e1	SMART
LamG	1040	1178	9.46e-15	SMART
transmembrane domain	1245	1267	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,065,695	E215G	probably benign	Het
4932438A13Rik	T	A	3: 36,948,341	H1478Q	probably benign	Het
4932438A13Rik	A	T	3: 36,983,394	H2448L	probably benign	Het
Adam8	T	A	7: 139,992,481		probably benign	Het
Ankrd35	A	G	3: 96,684,788	S797G	not run	Het
Anxa3	T	A	5: 96,834,821	H259Q	probably benign	Het
Ap3d1	T	A	10: 80,721,592	Q302L	probably damaging	Het
Atg2a	T	C	19: 6,255,652	V1294A	probably benign	Het
Atp13a5	G	A	16: 29,297,460	Q613*	probably null	Het
Bmpr2	T	G	1: 59,867,351	N534K	probably benign	Het
C1qbp	T	C	11: 70,978,246		probably null	Het
C1qbp	G	T	11: 70,978,247		probably null	Het
C1ql3	T	G	2: 13,010,418	K144Q	possibly damaging	Het
C3	T	C	17: 57,204,039	M1656V	possibly damaging	Het
Cand1	A	T	10: 119,216,243	Y252N	probably benign	Het
Capn13	T	C	17: 73,318,058	I632M	probably benign	Het
Catsperb	A	G	12: 101,591,498	E776G	probably damaging	Het
Ccnl1	A	T	3: 65,948,758	V242D	probably damaging	Het
Cd68	T	C	11: 69,665,112	D200G	probably benign	Het
Cela3a	T	C	4: 137,405,588	N118D	probably benign	Het
Celsr2	A	G	3: 108,402,457	C1609R	probably damaging	Het
Cep85l	G	C	10: 53,301,570	Q458E	probably damaging	Het
Cnga1	T	G	5: 72,609,525	E190D	probably benign	Het
Cntrob	G	A	11: 69,314,734	Q425*	probably null	Het
Commd9	G	A	2: 101,899,900	W128*	probably null	Het
Csnk1a1	C	T	18: 61,585,259	S352L	unknown	Het
Dact2	A	G	17: 14,196,331	S536P	probably damaging	Het
Ddx25	A	G	9: 35,554,586	I113T	probably benign	Het
Dscam	T	A	16: 96,629,398	D1630V	probably damaging	Het
Fndc7	A	C	3: 108,876,659	F211L	probably benign	Het
Fryl	T	C	5: 73,104,748	T559A	probably damaging	Het
Hpx	C	A	7: 105,591,861	D402Y	probably damaging	Het
Ints13	A	G	6: 146,574,700		probably null	Het
Ipcef1	T	C	10: 6,956,066	K76E	probably damaging	Het
Kcnb2	A	C	1: 15,709,807	Q301P	probably damaging	Het
Lamp3	C	T	16: 19,699,612		probably null	Het
Lmod2	A	T	6: 24,603,476	H150L	probably benign	Het
Lrch3	T	C	16: 33,005,707	F718S	probably damaging	Het
Mms22l	T	C	4: 24,596,287	V1082A	probably benign	Het
Nbas	G	T	12: 13,469,880	V1598L	probably damaging	Het
Nrxn3	C	T	12: 89,513,100	R671*	probably null	Het
Olfr1215	A	T	2: 89,002,200	F29L		Het
Olfr1441	A	C	19: 12,422,840	H177P	probably damaging	Het
Olfr214	A	T	6: 116,556,437	E4V	possibly damaging	Het
Olfr48	A	G	2: 89,844,445	L176P	probably damaging	Het
Olfr671	A	T	7: 104,975,061	L312*	probably null	Het
Pcdhga6	T	A	18: 37,708,566	N446K	probably damaging	Het
Phlpp1	A	T	1: 106,392,573	I1433F	probably benign	Het
Pla2g6	G	A	15: 79,308,733	R245C	probably damaging	Het
Rgl3	G	A	9: 21,976,827	Q464*	probably null	Het
Ryr2	T	C	13: 11,705,644	D2706G	probably benign	Het
Sbf2	G	A	7: 110,375,777	Q718*	probably null	Het
Sdad1	T	C	5: 92,300,121	T252A	probably benign	Het
Sgk1	T	C	10: 21,994,110	L16P	probably damaging	Het
Slc38a8	A	G	8: 119,485,588	S339P	possibly damaging	Het
Slc44a4	T	C	17: 34,921,691	S287P	possibly damaging	Het
Syne1	T	C	10: 5,425,760	I111V	probably damaging	Het
Synm	A	C	7: 67,733,446	S1489R	probably damaging	Het
Tfb2m	A	G	1: 179,537,704	F232L	probably benign	Het
Traf3	A	T	12: 111,260,661	K328*	probably null	Het
Trim38	C	A	13: 23,788,382	Q229K	probably benign	Het
Vcan	A	G	13: 89,689,832	I2531T	probably damaging	Het
Virma	T	A	4: 11,546,211	I1683N	possibly damaging	Het
Vmn1r18	A	T	6: 57,390,566	M1K	probably null	Het
Vmn2r87	T	C	10: 130,478,892	N275S	probably damaging	Het
Vps13a	T	A	19: 16,723,702	H701L	probably benign	Het
Vrk3	T	A	7: 44,770,924		probably null	Het
Zfp993	T	A	4: 146,657,641	S141T	possibly damaging	Het

Other mutations in Cntnap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cntnap3	APN	13	64772731	missense	probably damaging	1.00
IGL00782:Cntnap3	APN	13	64745805	splice site	probably benign
IGL00976:Cntnap3	APN	13	64794352	missense	probably damaging	1.00
IGL01319:Cntnap3	APN	13	64787837	missense	probably damaging	1.00
IGL01610:Cntnap3	APN	13	64757301	missense	probably damaging	0.98
IGL01861:Cntnap3	APN	13	64799108	missense	probably damaging	1.00
IGL02127:Cntnap3	APN	13	64799064	splice site	probably benign
IGL02133:Cntnap3	APN	13	64751673	splice site	probably benign
IGL02251:Cntnap3	APN	13	64762036	missense	probably damaging	1.00
IGL02272:Cntnap3	APN	13	64757411	missense	probably damaging	1.00
IGL02370:Cntnap3	APN	13	64751751	missense	probably benign
IGL02456:Cntnap3	APN	13	64799058	splice site	probably benign
IGL02589:Cntnap3	APN	13	64792430	missense	probably benign	0.08
IGL02695:Cntnap3	APN	13	64772132	missense	probably benign	0.01
IGL02850:Cntnap3	APN	13	64757409	missense	probably damaging	1.00
IGL03038:Cntnap3	APN	13	64741025	missense	possibly damaging	0.50
IGL03188:Cntnap3	APN	13	64781745	missense	probably damaging	0.97
IGL03327:Cntnap3	APN	13	64887768	nonsense	probably null
PIT4480001:Cntnap3	UTSW	13	64757210	missense	probably damaging	1.00
R0309:Cntnap3	UTSW	13	64757436	splice site	probably benign
R0422:Cntnap3	UTSW	13	64757285	missense	probably damaging	0.96
R0463:Cntnap3	UTSW	13	64778876	missense	probably damaging	1.00
R0491:Cntnap3	UTSW	13	64762045	missense	probably benign	0.01
R0499:Cntnap3	UTSW	13	64858678	missense	probably benign	0.33
R0550:Cntnap3	UTSW	13	64762000	missense	possibly damaging	0.86
R0613:Cntnap3	UTSW	13	64758414	missense	probably damaging	1.00
R0666:Cntnap3	UTSW	13	64757397	missense	probably damaging	1.00
R0840:Cntnap3	UTSW	13	64787910	missense	possibly damaging	0.94
R1577:Cntnap3	UTSW	13	64758290	missense	probably damaging	1.00
R1716:Cntnap3	UTSW	13	64762002	missense	probably damaging	1.00
R1732:Cntnap3	UTSW	13	64740812	critical splice donor site	probably null
R1739:Cntnap3	UTSW	13	64740592	missense	probably benign	0.17
R1905:Cntnap3	UTSW	13	64903764	missense	probably benign	0.04
R1988:Cntnap3	UTSW	13	64758390	missense	probably damaging	1.00
R2086:Cntnap3	UTSW	13	64794262	missense	possibly damaging	0.76
R3732:Cntnap3	UTSW	13	64740999	missense	possibly damaging	0.73
R3808:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R3809:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R4384:Cntnap3	UTSW	13	64748460	missense	probably damaging	1.00
R4433:Cntnap3	UTSW	13	64778853	missense	possibly damaging	0.92
R4631:Cntnap3	UTSW	13	64778883	missense	probably benign	0.04
R4645:Cntnap3	UTSW	13	64778788	critical splice donor site	probably null
R4702:Cntnap3	UTSW	13	64778862	missense	probably benign	0.17
R4876:Cntnap3	UTSW	13	64787706	missense	probably benign	0.00
R4994:Cntnap3	UTSW	13	64761984	missense	possibly damaging	0.55
R5043:Cntnap3	UTSW	13	64794348	missense	probably damaging	1.00
R5214:Cntnap3	UTSW	13	64762010	missense	probably damaging	1.00
R5403:Cntnap3	UTSW	13	64761978	missense	possibly damaging	0.90
R5571:Cntnap3	UTSW	13	64903758	missense	probably damaging	0.98
R5587:Cntnap3	UTSW	13	64746738	missense	probably damaging	1.00
R5695:Cntnap3	UTSW	13	64787955	missense	probably damaging	0.99
R5834:Cntnap3	UTSW	13	64748577	missense	probably benign	0.07
R5892:Cntnap3	UTSW	13	64799180	missense	probably damaging	1.00
R5950:Cntnap3	UTSW	13	64787769	missense	probably damaging	1.00
R6526:Cntnap3	UTSW	13	64781888	missense	possibly damaging	0.96
R6954:Cntnap3	UTSW	13	64748559	missense	probably benign	0.00
R7138:Cntnap3	UTSW	13	64781725	critical splice donor site	probably null
R7355:Cntnap3	UTSW	13	64771962	missense	probably benign
R7521:Cntnap3	UTSW	13	64772001	missense	probably benign	0.22
R7719:Cntnap3	UTSW	13	64772777	nonsense	probably null
R7810:Cntnap3	UTSW	13	64793308	missense	possibly damaging	0.73
R7871:Cntnap3	UTSW	13	64903773	missense	probably benign	0.00
R8259:Cntnap3	UTSW	13	64787867	missense	probably damaging	0.99
R8415:Cntnap3	UTSW	13	64738665	missense	probably benign	0.31
R8491:Cntnap3	UTSW	13	64785343	missense	probably damaging	1.00
R9086:Cntnap3	UTSW	13	64781759	missense	probably damaging	1.00
R9087:Cntnap3	UTSW	13	64751718	missense	probably damaging	0.96
R9398:Cntnap3	UTSW	13	64903834	missense	probably benign	0.41
R9475:Cntnap3	UTSW	13	64799135	missense	probably damaging	1.00
R9625:Cntnap3	UTSW	13	64858765	missense	probably damaging	1.00
R9679:Cntnap3	UTSW	13	64751748	missense	probably damaging	1.00
Z1176:Cntnap3	UTSW	13	64740872	frame shift	probably null
Z1176:Cntnap3	UTSW	13	64792388	missense	probably damaging	0.98
Z1177:Cntnap3	UTSW	13	64781892	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GTATGTGCCCATGACTAGAATAAC -3'
(R):5'- ACCAGAGTCATTTTGGAACTCAG -3'

Sequencing Primer
(F):5'- GTGCCCATGACTAGAATAACAAATAG -3'
(R):5'- AGAGTCATTTTGGAACTCAGCTTCC -3'

Posted On

2019-10-07