Incidental Mutation 'R7425:Slc44a4'
ID576021
Institutional Source Beutler Lab
Gene Symbol Slc44a4
Ensembl Gene ENSMUSG00000007034
Gene Namesolute carrier family 44, member 4
Synonyms2210409B01Rik, NG22
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7425 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location34914466-34930436 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34921691 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 287 (S287P)
Ref Sequence ENSEMBL: ENSMUSP00000007249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007249] [ENSMUST00000169230]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007249
AA Change: S287P

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000007249
Gene: ENSMUSG00000007034
AA Change: S287P

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
transmembrane domain 250 272 N/A INTRINSIC
Pfam:Choline_transpo 311 674 5.4e-119 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000169230
AA Change: S135P

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132965
Gene: ENSMUSG00000007034
AA Change: S135P

DomainStartEndE-ValueType
transmembrane domain 74 96 N/A INTRINSIC
transmembrane domain 98 120 N/A INTRINSIC
Pfam:Choline_transpo 157 524 3.9e-129 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may be a sodium-dependent transmembrane transport protein involved in the uptake of choline by cholinergic neurons. Defects in this gene can cause sialidosis, a lysosomal storage disease. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,695 E215G probably benign Het
4932438A13Rik T A 3: 36,948,341 H1478Q probably benign Het
4932438A13Rik A T 3: 36,983,394 H2448L probably benign Het
Adam8 T A 7: 139,992,481 probably benign Het
Ankrd35 A G 3: 96,684,788 S797G not run Het
Anxa3 T A 5: 96,834,821 H259Q probably benign Het
Ap3d1 T A 10: 80,721,592 Q302L probably damaging Het
Atg2a T C 19: 6,255,652 V1294A probably benign Het
Atp13a5 G A 16: 29,297,460 Q613* probably null Het
Bmpr2 T G 1: 59,867,351 N534K probably benign Het
C1qbp T C 11: 70,978,246 probably null Het
C1qbp G T 11: 70,978,247 probably null Het
C1ql3 T G 2: 13,010,418 K144Q possibly damaging Het
C3 T C 17: 57,204,039 M1656V possibly damaging Het
Cand1 A T 10: 119,216,243 Y252N probably benign Het
Capn13 T C 17: 73,318,058 I632M probably benign Het
Catsperb A G 12: 101,591,498 E776G probably damaging Het
Ccnl1 A T 3: 65,948,758 V242D probably damaging Het
Cd68 T C 11: 69,665,112 D200G probably benign Het
Cela3a T C 4: 137,405,588 N118D probably benign Het
Celsr2 A G 3: 108,402,457 C1609R probably damaging Het
Cep85l G C 10: 53,301,570 Q458E probably damaging Het
Cnga1 T G 5: 72,609,525 E190D probably benign Het
Cntnap3 G A 13: 64,758,252 R847C probably damaging Het
Cntrob G A 11: 69,314,734 Q425* probably null Het
Commd9 G A 2: 101,899,900 W128* probably null Het
Csnk1a1 C T 18: 61,585,259 S352L unknown Het
Dact2 A G 17: 14,196,331 S536P probably damaging Het
Ddx25 A G 9: 35,554,586 I113T probably benign Het
Dscam T A 16: 96,629,398 D1630V probably damaging Het
Fndc7 A C 3: 108,876,659 F211L probably benign Het
Fryl T C 5: 73,104,748 T559A probably damaging Het
Hpx C A 7: 105,591,861 D402Y probably damaging Het
Ints13 A G 6: 146,574,700 probably null Het
Ipcef1 T C 10: 6,956,066 K76E probably damaging Het
Kcnb2 A C 1: 15,709,807 Q301P probably damaging Het
Lamp3 C T 16: 19,699,612 probably null Het
Lmod2 A T 6: 24,603,476 H150L probably benign Het
Lrch3 T C 16: 33,005,707 F718S probably damaging Het
Mms22l T C 4: 24,596,287 V1082A probably benign Het
Nbas G T 12: 13,469,880 V1598L probably damaging Het
Nrxn3 C T 12: 89,513,100 R671* probably null Het
Olfr1215 A T 2: 89,002,200 F29L Het
Olfr1441 A C 19: 12,422,840 H177P probably damaging Het
Olfr214 A T 6: 116,556,437 E4V possibly damaging Het
Olfr48 A G 2: 89,844,445 L176P probably damaging Het
Olfr671 A T 7: 104,975,061 L312* probably null Het
Pcdhga6 T A 18: 37,708,566 N446K probably damaging Het
Phlpp1 A T 1: 106,392,573 I1433F probably benign Het
Pla2g6 G A 15: 79,308,733 R245C probably damaging Het
Rgl3 G A 9: 21,976,827 Q464* probably null Het
Ryr2 T C 13: 11,705,644 D2706G probably benign Het
Sbf2 G A 7: 110,375,777 Q718* probably null Het
Sdad1 T C 5: 92,300,121 T252A probably benign Het
Sgk1 T C 10: 21,994,110 L16P probably damaging Het
Slc38a8 A G 8: 119,485,588 S339P possibly damaging Het
Syne1 T C 10: 5,425,760 I111V probably damaging Het
Synm A C 7: 67,733,446 S1489R probably damaging Het
Tfb2m A G 1: 179,537,704 F232L probably benign Het
Traf3 A T 12: 111,260,661 K328* probably null Het
Trim38 C A 13: 23,788,382 Q229K probably benign Het
Vcan A G 13: 89,689,832 I2531T probably damaging Het
Virma T A 4: 11,546,211 I1683N possibly damaging Het
Vmn1r18 A T 6: 57,390,566 M1K probably null Het
Vmn2r87 T C 10: 130,478,892 N275S probably damaging Het
Vps13a T A 19: 16,723,702 H701L probably benign Het
Vrk3 T A 7: 44,770,924 probably null Het
Zfp993 T A 4: 146,657,641 S141T possibly damaging Het
Other mutations in Slc44a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Slc44a4 APN 17 34930240 utr 3 prime probably benign
IGL01097:Slc44a4 APN 17 34921569 missense probably damaging 0.97
IGL01296:Slc44a4 APN 17 34921698 missense probably benign 0.39
IGL01606:Slc44a4 APN 17 34929018 missense probably damaging 1.00
IGL01759:Slc44a4 APN 17 34921243 missense probably benign 0.00
IGL02026:Slc44a4 APN 17 34921856 splice site probably benign
IGL02119:Slc44a4 APN 17 34928661 missense probably damaging 1.00
IGL02338:Slc44a4 APN 17 34923810 missense possibly damaging 0.90
IGL02383:Slc44a4 APN 17 34927710 missense probably benign 0.00
IGL02526:Slc44a4 APN 17 34928487 missense probably damaging 0.99
IGL02744:Slc44a4 APN 17 34927800 missense probably damaging 1.00
IGL02754:Slc44a4 APN 17 34921303 missense probably damaging 0.98
ANU74:Slc44a4 UTSW 17 34921578 missense probably damaging 1.00
PIT4142001:Slc44a4 UTSW 17 34921275 missense probably damaging 0.99
R0007:Slc44a4 UTSW 17 34921254 missense probably damaging 0.99
R0007:Slc44a4 UTSW 17 34921254 missense probably damaging 0.99
R0452:Slc44a4 UTSW 17 34928095 missense possibly damaging 0.82
R0894:Slc44a4 UTSW 17 34928490 missense possibly damaging 0.92
R1136:Slc44a4 UTSW 17 34928022 missense probably damaging 1.00
R1224:Slc44a4 UTSW 17 34921868 missense probably benign 0.18
R1779:Slc44a4 UTSW 17 34921925 missense probably damaging 1.00
R2679:Slc44a4 UTSW 17 34923423 splice site probably benign
R3499:Slc44a4 UTSW 17 34921680 missense probably benign 0.02
R3732:Slc44a4 UTSW 17 34921561 synonymous silent
R4084:Slc44a4 UTSW 17 34917347 missense probably damaging 1.00
R4197:Slc44a4 UTSW 17 34918252 missense probably benign 0.12
R4536:Slc44a4 UTSW 17 34923839 missense probably damaging 1.00
R4547:Slc44a4 UTSW 17 34927755 missense probably damaging 1.00
R5093:Slc44a4 UTSW 17 34921243 missense probably benign 0.00
R6005:Slc44a4 UTSW 17 34923454 missense possibly damaging 0.69
R6396:Slc44a4 UTSW 17 34928884 nonsense probably null
R6660:Slc44a4 UTSW 17 34930225 missense probably damaging 0.99
R6860:Slc44a4 UTSW 17 34921068 missense probably damaging 1.00
R6863:Slc44a4 UTSW 17 34923822 missense probably benign 0.41
R6947:Slc44a4 UTSW 17 34928068 missense probably null 1.00
R7250:Slc44a4 UTSW 17 34918544 critical splice donor site probably null
R7297:Slc44a4 UTSW 17 34927912 missense probably damaging 0.98
R7696:Slc44a4 UTSW 17 34928700 missense probably damaging 1.00
R7871:Slc44a4 UTSW 17 34923852 critical splice donor site probably null
R7954:Slc44a4 UTSW 17 34923852 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTTCCTTACATGCAGAGCGC -3'
(R):5'- TCTGGCGCAGGAAAATGAGC -3'

Sequencing Primer
(F):5'- TACATGCAGAGCGCTGGGTG -3'
(R):5'- GCCAGGACAATCACTGCATGG -3'
Posted On2019-10-07