Incidental Mutation 'R7425:Csnk1a1'
ID576025
Institutional Source Beutler Lab
Gene Symbol Csnk1a1
Ensembl Gene ENSMUSG00000024576
Gene Namecasein kinase 1, alpha 1
Synonyms4632404G05Rik, CK1a, 5430427P18Rik, 2610208K14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7425 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location61555274-61590061 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61585259 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 352 (S352L)
Ref Sequence ENSEMBL: ENSMUSP00000131687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115246] [ENSMUST00000163205] [ENSMUST00000165123] [ENSMUST00000165721] [ENSMUST00000166990] [ENSMUST00000167187] [ENSMUST00000170862]
Predicted Effect probably benign
Transcript: ENSMUST00000115246
SMART Domains Protein: ENSMUSP00000110901
Gene: ENSMUSG00000024576

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 17 281 1.7e-15 PFAM
Pfam:Pkinase 17 292 3.7e-39 PFAM
low complexity region 302 320 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163205
SMART Domains Protein: ENSMUSP00000127144
Gene: ENSMUSG00000024576

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 17 281 2.6e-15 PFAM
Pfam:Pkinase 17 292 5.6e-39 PFAM
low complexity region 302 327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164253
SMART Domains Protein: ENSMUSP00000129295
Gene: ENSMUSG00000024576

DomainStartEndE-ValueType
PDB:4JJR|B 2 114 9e-52 PDB
SCOP:d1csn__ 6 114 5e-26 SMART
low complexity region 115 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165123
SMART Domains Protein: ENSMUSP00000128871
Gene: ENSMUSG00000024576

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 17 281 1.3e-15 PFAM
Pfam:Pkinase 17 292 2.9e-39 PFAM
low complexity region 302 320 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165721
SMART Domains Protein: ENSMUSP00000132083
Gene: ENSMUSG00000024576

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 17 281 1.5e-15 PFAM
Pfam:Pkinase 17 293 3.2e-39 PFAM
low complexity region 302 327 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000166990
AA Change: S352L
SMART Domains Protein: ENSMUSP00000131687
Gene: ENSMUSG00000024576
AA Change: S352L

DomainStartEndE-ValueType
Pfam:Pkinase 17 263 1e-28 PFAM
Pfam:Pkinase_Tyr 17 281 1.1e-15 PFAM
low complexity region 302 327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167187
SMART Domains Protein: ENSMUSP00000127463
Gene: ENSMUSG00000024576

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 17 309 1.5e-12 PFAM
Pfam:Pkinase 17 319 1e-37 PFAM
low complexity region 330 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170862
SMART Domains Protein: ENSMUSP00000127265
Gene: ENSMUSG00000024576

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 17 309 1.6e-12 PFAM
Pfam:Pkinase 17 320 1.1e-37 PFAM
low complexity region 330 355 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,695 E215G probably benign Het
4932438A13Rik T A 3: 36,948,341 H1478Q probably benign Het
4932438A13Rik A T 3: 36,983,394 H2448L probably benign Het
Adam8 T A 7: 139,992,481 probably benign Het
Ankrd35 A G 3: 96,684,788 S797G not run Het
Anxa3 T A 5: 96,834,821 H259Q probably benign Het
Ap3d1 T A 10: 80,721,592 Q302L probably damaging Het
Atg2a T C 19: 6,255,652 V1294A probably benign Het
Atp13a5 G A 16: 29,297,460 Q613* probably null Het
Bmpr2 T G 1: 59,867,351 N534K probably benign Het
C1qbp T C 11: 70,978,246 probably null Het
C1qbp G T 11: 70,978,247 probably null Het
C1ql3 T G 2: 13,010,418 K144Q possibly damaging Het
C3 T C 17: 57,204,039 M1656V possibly damaging Het
Cand1 A T 10: 119,216,243 Y252N probably benign Het
Capn13 T C 17: 73,318,058 I632M probably benign Het
Catsperb A G 12: 101,591,498 E776G probably damaging Het
Ccnl1 A T 3: 65,948,758 V242D probably damaging Het
Cd68 T C 11: 69,665,112 D200G probably benign Het
Cela3a T C 4: 137,405,588 N118D probably benign Het
Celsr2 A G 3: 108,402,457 C1609R probably damaging Het
Cep85l G C 10: 53,301,570 Q458E probably damaging Het
Cnga1 T G 5: 72,609,525 E190D probably benign Het
Cntnap3 G A 13: 64,758,252 R847C probably damaging Het
Cntrob G A 11: 69,314,734 Q425* probably null Het
Commd9 G A 2: 101,899,900 W128* probably null Het
Dact2 A G 17: 14,196,331 S536P probably damaging Het
Ddx25 A G 9: 35,554,586 I113T probably benign Het
Dscam T A 16: 96,629,398 D1630V probably damaging Het
Fndc7 A C 3: 108,876,659 F211L probably benign Het
Fryl T C 5: 73,104,748 T559A probably damaging Het
Hpx C A 7: 105,591,861 D402Y probably damaging Het
Ints13 A G 6: 146,574,700 probably null Het
Ipcef1 T C 10: 6,956,066 K76E probably damaging Het
Kcnb2 A C 1: 15,709,807 Q301P probably damaging Het
Lamp3 C T 16: 19,699,612 probably null Het
Lmod2 A T 6: 24,603,476 H150L probably benign Het
Lrch3 T C 16: 33,005,707 F718S probably damaging Het
Mms22l T C 4: 24,596,287 V1082A probably benign Het
Nbas G T 12: 13,469,880 V1598L probably damaging Het
Nrxn3 C T 12: 89,513,100 R671* probably null Het
Olfr1215 A T 2: 89,002,200 F29L Het
Olfr1441 A C 19: 12,422,840 H177P probably damaging Het
Olfr214 A T 6: 116,556,437 E4V possibly damaging Het
Olfr48 A G 2: 89,844,445 L176P probably damaging Het
Olfr671 A T 7: 104,975,061 L312* probably null Het
Pcdhga6 T A 18: 37,708,566 N446K probably damaging Het
Phlpp1 A T 1: 106,392,573 I1433F probably benign Het
Pla2g6 G A 15: 79,308,733 R245C probably damaging Het
Rgl3 G A 9: 21,976,827 Q464* probably null Het
Ryr2 T C 13: 11,705,644 D2706G probably benign Het
Sbf2 G A 7: 110,375,777 Q718* probably null Het
Sdad1 T C 5: 92,300,121 T252A probably benign Het
Sgk1 T C 10: 21,994,110 L16P probably damaging Het
Slc38a8 A G 8: 119,485,588 S339P possibly damaging Het
Slc44a4 T C 17: 34,921,691 S287P possibly damaging Het
Syne1 T C 10: 5,425,760 I111V probably damaging Het
Synm A C 7: 67,733,446 S1489R probably damaging Het
Tfb2m A G 1: 179,537,704 F232L probably benign Het
Traf3 A T 12: 111,260,661 K328* probably null Het
Trim38 C A 13: 23,788,382 Q229K probably benign Het
Vcan A G 13: 89,689,832 I2531T probably damaging Het
Virma T A 4: 11,546,211 I1683N possibly damaging Het
Vmn1r18 A T 6: 57,390,566 M1K probably null Het
Vmn2r87 T C 10: 130,478,892 N275S probably damaging Het
Vps13a T A 19: 16,723,702 H701L probably benign Het
Vrk3 T A 7: 44,770,924 probably null Het
Zfp993 T A 4: 146,657,641 S141T possibly damaging Het
Other mutations in Csnk1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00939:Csnk1a1 APN 18 61575450 missense probably damaging 1.00
IGL00984:Csnk1a1 APN 18 61575553 splice site probably benign
IGL03107:Csnk1a1 APN 18 61568305 missense probably damaging 1.00
R0513:Csnk1a1 UTSW 18 61576547 missense probably damaging 0.99
R1068:Csnk1a1 UTSW 18 61569563 critical splice donor site probably null
R1511:Csnk1a1 UTSW 18 61585250 intron probably benign
R1855:Csnk1a1 UTSW 18 61575427 unclassified probably null
R2944:Csnk1a1 UTSW 18 61578689 missense probably benign 0.02
R4426:Csnk1a1 UTSW 18 61585310 intron probably benign
R4893:Csnk1a1 UTSW 18 61585301 intron probably benign
R5000:Csnk1a1 UTSW 18 61578769 missense probably damaging 1.00
R5070:Csnk1a1 UTSW 18 61555781 missense probably benign 0.02
R5095:Csnk1a1 UTSW 18 61575476 missense probably damaging 1.00
R6523:Csnk1a1 UTSW 18 61555758 missense probably benign 0.01
R6601:Csnk1a1 UTSW 18 61578758 missense probably damaging 1.00
R7617:Csnk1a1 UTSW 18 61585316 missense unknown
X0028:Csnk1a1 UTSW 18 61578632 intron probably null
X0064:Csnk1a1 UTSW 18 61569564 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGCAGGTGAAACTGTCTCAAGAC -3'
(R):5'- TTTCTTCAGCTAGACAGGCC -3'

Sequencing Primer
(F):5'- ACAGATTTCTTTTTGAGGGGATAAAG -3'
(R):5'- TTCAGCTAGACAGGCCAACGG -3'
Posted On2019-10-07