Incidental Mutation 'R7426:Cfap65'
ID 576031
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Name cilia and flagella associated protein 65
Synonyms Ccdc108, B230363K08Rik
MMRRC Submission 045504-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.677) question?
Stock # R7426 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 74941230-74974758 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 74959585 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 855 (V855A)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
AlphaFold Q3V0B4
Predicted Effect possibly damaging
Transcript: ENSMUST00000094844
AA Change: V855A

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: V855A

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (114/118)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 C A 7: 119,945,221 (GRCm39) N432K possibly damaging Het
Abitram A G 4: 56,804,230 (GRCm39) I82V probably null Het
Adamtsl5 G A 10: 80,180,693 (GRCm39) T123I probably benign Het
Aff4 T C 11: 53,263,702 (GRCm39) S241P probably damaging Het
Agl A G 3: 116,552,404 (GRCm39) L510P Het
Aox1 A T 1: 58,329,142 (GRCm39) K196* probably null Het
Arhgef37 A G 18: 61,637,456 (GRCm39) L402P probably damaging Het
Arid4b T C 13: 14,355,891 (GRCm39) probably null Het
Atp5pb A G 3: 105,851,118 (GRCm39) V193A probably benign Het
Atp8b3 A G 10: 80,365,463 (GRCm39) probably null Het
Baz2a G T 10: 127,951,947 (GRCm39) R555L probably damaging Het
Casp4 G T 9: 5,321,345 (GRCm39) S32I possibly damaging Het
Cd300lb A G 11: 114,819,128 (GRCm39) V167A probably damaging Het
Cdc42bpg C T 19: 6,368,428 (GRCm39) T1042I probably damaging Het
Ceacam20 T C 7: 19,704,159 (GRCm39) F70S probably damaging Het
Cep162 C T 9: 87,074,819 (GRCm39) V1388I probably damaging Het
Chil3 G T 3: 106,063,022 (GRCm39) D189E probably benign Het
Cln3 A G 7: 126,180,912 (GRCm39) I43T probably benign Het
Cntnap5a A G 1: 116,370,110 (GRCm39) Q909R probably benign Het
Ctsd C A 7: 141,937,278 (GRCm39) A77S probably damaging Het
Dnah12 T A 14: 26,445,781 (GRCm39) S781T probably benign Het
Dnah17 T A 11: 117,981,543 (GRCm39) Q1716L probably null Het
Dock3 C A 9: 106,772,782 (GRCm39) M490I probably benign Het
Erg T C 16: 95,260,015 (GRCm39) probably null Het
Farp2 A T 1: 93,548,950 (GRCm39) M1019L possibly damaging Het
Fcgbp A G 7: 27,785,949 (GRCm39) K462R probably benign Het
Fn1 A T 1: 71,688,384 (GRCm39) N173K probably damaging Het
Fsip2 A T 2: 82,810,441 (GRCm39) L2253F probably damaging Het
Gabrd C T 4: 155,469,970 (GRCm39) R413H possibly damaging Het
Galnt5 A T 2: 57,907,151 (GRCm39) D538V probably damaging Het
Gje1 T A 10: 14,592,223 (GRCm39) L186F probably damaging Het
Gm16686 A T 4: 88,673,563 (GRCm39) C89S unknown Het
Gna15 G T 10: 81,338,831 (GRCm39) A336E probably benign Het
Golga4 C T 9: 118,388,563 (GRCm39) S1895L probably benign Het
Gon4l A T 3: 88,814,829 (GRCm39) M1933L probably benign Het
Gpr183 T C 14: 122,192,156 (GRCm39) S122G possibly damaging Het
Gtf2h4 G A 17: 35,980,250 (GRCm39) T348I probably damaging Het
Hace1 T C 10: 45,481,636 (GRCm39) Y120H probably damaging Het
Hivep2 C T 10: 14,007,061 (GRCm39) H1220Y possibly damaging Het
Hmx2 T C 7: 131,156,232 (GRCm39) F66S probably benign Het
Hoxd12 A T 2: 74,505,569 (GRCm39) S47C possibly damaging Het
Hp C A 8: 110,301,832 (GRCm39) probably null Het
Idh3a T A 9: 54,508,492 (GRCm39) D355E probably benign Het
Itga2b A T 11: 102,347,120 (GRCm39) M921K probably benign Het
Jcad A G 18: 4,675,529 (GRCm39) D1097G probably benign Het
Kdm5b A T 1: 134,523,571 (GRCm39) T249S probably benign Het
Klhl11 G T 11: 100,355,178 (GRCm39) H214Q probably benign Het
L3hypdh A T 12: 72,131,705 (GRCm39) Y76N probably damaging Het
Lama4 G T 10: 38,921,751 (GRCm39) R424L possibly damaging Het
Lepr A G 4: 101,602,853 (GRCm39) I214V probably benign Het
Lipc G T 9: 70,709,450 (GRCm39) N432K probably benign Het
Lipm C T 19: 34,093,598 (GRCm39) A216V possibly damaging Het
Lrrc23 A G 6: 124,756,088 (GRCm39) S2P unknown Het
Lyst T A 13: 13,812,109 (GRCm39) D840E probably benign Het
Mmp23 T A 4: 155,736,041 (GRCm39) T204S probably damaging Het
Mms19 T C 19: 41,936,717 (GRCm39) T785A probably benign Het
Mov10 A T 3: 104,707,368 (GRCm39) probably null Het
Mtf2 A G 5: 108,248,836 (GRCm39) T383A probably benign Het
Myo5c G A 9: 75,158,809 (GRCm39) probably null Het
Nfxl1 A T 5: 72,681,517 (GRCm39) C671* probably null Het
Npepps A G 11: 97,103,982 (GRCm39) V813A probably benign Het
Nrn1 C A 13: 36,910,825 (GRCm39) W69L probably damaging Het
Oprd1 A C 4: 131,841,378 (GRCm39) D193E probably benign Het
Or2ag1b T A 7: 106,288,417 (GRCm39) I174F possibly damaging Het
Or52p1 C T 7: 104,267,059 (GRCm39) H58Y probably damaging Het
Or55b3 A T 7: 102,126,883 (GRCm39) Y65N probably damaging Het
Or56b2j T A 7: 104,352,796 (GRCm39) D7E probably benign Het
Or6c202 A G 10: 128,996,620 (GRCm39) Y78H possibly damaging Het
Or6c209 T C 10: 129,483,027 (GRCm39) I10T probably damaging Het
Or6k6 A C 1: 173,944,753 (GRCm39) F276L probably benign Het
Pcdhac1 G T 18: 37,225,550 (GRCm39) V788L probably benign Het
Pcdhb11 G A 18: 37,556,313 (GRCm39) V548M probably damaging Het
Pde4c A T 8: 71,201,621 (GRCm39) E517V possibly damaging Het
Pdzd7 T C 19: 45,022,086 (GRCm39) R521G possibly damaging Het
Pik3c2a T A 7: 115,972,089 (GRCm39) K780N probably damaging Het
Plb1 T G 5: 32,478,591 (GRCm39) probably null Het
Plcb4 T A 2: 135,842,139 (GRCm39) L1041Q probably benign Het
Pnpla6 G A 8: 3,566,540 (GRCm39) probably null Het
Ppat A T 5: 77,063,826 (GRCm39) N441K probably damaging Het
Ppp1r1b G A 11: 98,246,305 (GRCm39) A132T probably damaging Het
Prl2c2 A C 13: 13,172,065 (GRCm39) probably null Het
Prr14 T C 7: 127,074,458 (GRCm39) I330T probably benign Het
Pycr1 T C 11: 120,533,749 (GRCm39) D36G probably benign Het
Rabep2 T A 7: 126,037,891 (GRCm39) I221N probably damaging Het
Rad23b A G 4: 55,370,469 (GRCm39) D165G probably benign Het
Reln G A 5: 22,176,951 (GRCm39) T1905I probably damaging Het
Ripor2 T C 13: 24,878,188 (GRCm39) V321A probably benign Het
Rnf43 A G 11: 87,622,678 (GRCm39) D466G probably benign Het
Rpl6 A T 5: 121,343,655 (GRCm39) R63W possibly damaging Het
S100a14 A G 3: 90,435,511 (GRCm39) T102A probably benign Het
Samd11 C A 4: 156,333,857 (GRCm39) V195L probably benign Het
Scaper G A 9: 55,669,561 (GRCm39) Q372* probably null Het
Sec14l5 G T 16: 4,998,739 (GRCm39) C593F probably damaging Het
Sema6d T C 2: 124,496,078 (GRCm39) Y41H probably damaging Het
Serac1 G A 17: 6,119,589 (GRCm39) R114W probably damaging Het
Slc12a4 T C 8: 106,677,468 (GRCm39) E388G probably benign Het
Smarcd3 T C 5: 24,800,810 (GRCm39) T164A probably benign Het
Smtn C A 11: 3,480,249 (GRCm39) R324L probably benign Het
Spata31d1c C T 13: 65,183,175 (GRCm39) P239L probably benign Het
Srcap T C 7: 127,137,689 (GRCm39) V1013A possibly damaging Het
Sv2b T C 7: 74,773,812 (GRCm39) N553S probably damaging Het
Tex35 T A 1: 156,932,656 (GRCm39) N52I probably damaging Het
Ticrr T C 7: 79,343,734 (GRCm39) S1200P probably benign Het
Tmem19 A G 10: 115,183,604 (GRCm39) L125P probably damaging Het
Trio A G 15: 27,856,193 (GRCm39) V666A probably benign Het
Ttn T C 2: 76,747,627 (GRCm39) D4474G probably benign Het
Usp43 A T 11: 67,783,842 (GRCm39) S368T possibly damaging Het
Vmn2r72 T A 7: 85,400,348 (GRCm39) M234L probably benign Het
Wdr93 T A 7: 79,427,055 (GRCm39) probably null Het
Wrap73 T A 4: 154,240,584 (GRCm39) W359R probably damaging Het
Ywhah A G 5: 33,183,985 (GRCm39) I63V probably benign Het
Zbtb7b G T 3: 89,288,366 (GRCm39) P151T probably damaging Het
Zfp318 A G 17: 46,710,995 (GRCm39) N906S probably damaging Het
Zfp423 C A 8: 88,507,341 (GRCm39) C1001F probably damaging Het
Zmym1 A G 4: 126,943,191 (GRCm39) I399T possibly damaging Het
Zmynd15 G A 11: 70,353,014 (GRCm39) G296D probably benign Het
Znfx1 T A 2: 166,890,475 (GRCm39) I670F probably damaging Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74,958,342 (GRCm39) critical splice donor site probably null
IGL01526:Cfap65 APN 1 74,950,237 (GRCm39) missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74,966,353 (GRCm39) missense probably benign
IGL01780:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL01993:Cfap65 APN 1 74,959,702 (GRCm39) missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74,967,304 (GRCm39) missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02357:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02576:Cfap65 APN 1 74,942,617 (GRCm39) missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74,944,239 (GRCm39) missense probably benign 0.00
IGL02792:Cfap65 APN 1 74,966,337 (GRCm39) missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74,950,267 (GRCm39) nonsense probably null
IGL03101:Cfap65 APN 1 74,967,592 (GRCm39) missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74,966,778 (GRCm39) missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74,943,801 (GRCm39) missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74,967,501 (GRCm39) missense probably benign 0.05
R0077:Cfap65 UTSW 1 74,971,077 (GRCm39) missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74,971,117 (GRCm39) nonsense probably null
R0281:Cfap65 UTSW 1 74,966,230 (GRCm39) missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74,943,226 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,461 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,460 (GRCm39) missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74,965,603 (GRCm39) missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74,959,760 (GRCm39) missense probably benign 0.00
R0361:Cfap65 UTSW 1 74,964,599 (GRCm39) missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74,956,043 (GRCm39) missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74,957,603 (GRCm39) missense probably benign 0.01
R0646:Cfap65 UTSW 1 74,941,328 (GRCm39) missense probably benign 0.09
R0734:Cfap65 UTSW 1 74,958,046 (GRCm39) missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74,943,841 (GRCm39) missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74,960,678 (GRCm39) missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74,944,872 (GRCm39) missense probably damaging 0.99
R1079:Cfap65 UTSW 1 74,941,606 (GRCm39) missense probably damaging 0.98
R1083:Cfap65 UTSW 1 74,957,663 (GRCm39) splice site probably benign
R1159:Cfap65 UTSW 1 74,968,499 (GRCm39) missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74,964,263 (GRCm39) missense probably benign 0.03
R1644:Cfap65 UTSW 1 74,956,334 (GRCm39) missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74,958,107 (GRCm39) missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74,946,819 (GRCm39) missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74,956,358 (GRCm39) missense probably benign 0.30
R2132:Cfap65 UTSW 1 74,946,850 (GRCm39) missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74,956,432 (GRCm39) frame shift probably null
R2219:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74,965,634 (GRCm39) missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74,966,345 (GRCm39) small insertion probably benign
R3114:Cfap65 UTSW 1 74,966,291 (GRCm39) missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74,959,701 (GRCm39) missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74,966,840 (GRCm39) missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74,942,517 (GRCm39) missense probably benign 0.17
R4547:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74,943,215 (GRCm39) missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74,964,513 (GRCm39) intron probably benign
R4701:Cfap65 UTSW 1 74,958,067 (GRCm39) missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74,967,520 (GRCm39) missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74,966,791 (GRCm39) missense probably benign 0.06
R4831:Cfap65 UTSW 1 74,956,454 (GRCm39) missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74,964,716 (GRCm39) missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74,958,420 (GRCm39) missense probably benign 0.00
R4881:Cfap65 UTSW 1 74,946,772 (GRCm39) missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74,942,283 (GRCm39) missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74,945,495 (GRCm39) nonsense probably null
R5074:Cfap65 UTSW 1 74,962,137 (GRCm39) missense probably benign 0.04
R5083:Cfap65 UTSW 1 74,945,600 (GRCm39) missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74,965,675 (GRCm39) missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74,964,061 (GRCm39) missense probably benign 0.07
R5333:Cfap65 UTSW 1 74,942,334 (GRCm39) missense probably benign 0.03
R5417:Cfap65 UTSW 1 74,964,259 (GRCm39) missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74,946,677 (GRCm39) intron probably benign
R5669:Cfap65 UTSW 1 74,964,127 (GRCm39) missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74,962,190 (GRCm39) missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74,959,564 (GRCm39) missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74,942,298 (GRCm39) missense probably benign 0.14
R6425:Cfap65 UTSW 1 74,966,868 (GRCm39) missense probably benign 0.00
R6677:Cfap65 UTSW 1 74,943,844 (GRCm39) missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74,956,445 (GRCm39) missense probably benign 0.00
R6838:Cfap65 UTSW 1 74,971,180 (GRCm39) missense probably benign 0.06
R6861:Cfap65 UTSW 1 74,964,274 (GRCm39) missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74,971,058 (GRCm39) missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74,965,792 (GRCm39) missense probably benign 0.01
R7320:Cfap65 UTSW 1 74,965,763 (GRCm39) missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74,960,742 (GRCm39) missense probably benign 0.07
R7529:Cfap65 UTSW 1 74,965,769 (GRCm39) missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74,941,593 (GRCm39) missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74,972,303 (GRCm39) missense probably benign 0.44
R7704:Cfap65 UTSW 1 74,967,527 (GRCm39) missense probably benign 0.19
R7727:Cfap65 UTSW 1 74,965,784 (GRCm39) missense probably benign 0.00
R7895:Cfap65 UTSW 1 74,972,321 (GRCm39) missense probably benign 0.05
R8215:Cfap65 UTSW 1 74,949,902 (GRCm39) missense probably damaging 1.00
R8344:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8345:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8413:Cfap65 UTSW 1 74,956,328 (GRCm39) nonsense probably null
R8431:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8432:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8528:Cfap65 UTSW 1 74,945,096 (GRCm39) missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74,942,382 (GRCm39) missense probably benign 0.43
R8996:Cfap65 UTSW 1 74,941,347 (GRCm39) missense probably benign 0.11
R9020:Cfap65 UTSW 1 74,959,552 (GRCm39) missense probably damaging 1.00
R9043:Cfap65 UTSW 1 74,943,847 (GRCm39) missense possibly damaging 0.88
R9127:Cfap65 UTSW 1 74,958,510 (GRCm39) splice site probably benign
R9187:Cfap65 UTSW 1 74,956,517 (GRCm39) missense probably benign 0.00
R9210:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9212:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9273:Cfap65 UTSW 1 74,960,769 (GRCm39) missense probably benign 0.00
R9454:Cfap65 UTSW 1 74,944,210 (GRCm39) missense probably damaging 1.00
R9514:Cfap65 UTSW 1 74,945,468 (GRCm39) critical splice donor site probably null
R9595:Cfap65 UTSW 1 74,946,537 (GRCm39) missense probably damaging 1.00
R9721:Cfap65 UTSW 1 74,958,501 (GRCm39) missense probably benign 0.16
R9742:Cfap65 UTSW 1 74,943,840 (GRCm39) missense probably benign 0.08
RF009:Cfap65 UTSW 1 74,944,806 (GRCm39) missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74,949,906 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTGACTAAAGCCCACTTGCAG -3'
(R):5'- CAAGAGGTCATGGCATTGTCC -3'

Sequencing Primer
(F):5'- TAAAGCCCACTTGCAGGCTAGG -3'
(R):5'- TCCTCTGGCTCAGGAAGTG -3'
Posted On 2019-10-07