Mutagenetix > Incidental Mutation

Incidental Mutation 'R7426:Lepr'

576053

Institutional Source

Beutler Lab

Gene Symbol

Lepr

Ensembl Gene

ENSMUSG00000057722

Gene Name

leptin receptor

Synonyms

obl, Leprb, Obr, obese-like, OB-RGRP, Modb1, leptin receptor gene-related protein, LEPROT

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7426 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101717404-101815352 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 101745656 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 214 (I214V)

Ref Sequence

ENSEMBL: ENSMUSP00000037385 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037552] [ENSMUST00000102777] [ENSMUST00000106921]

AlphaFold

P48356

Predicted Effect

probably benign
Transcript: ENSMUST00000037552
AA Change: I214V

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000037385
Gene: ENSMUSG00000057722
AA Change: I214V

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
FN3	236	315	1.5e-5	SMART
Pfam:Lep_receptor_Ig	328	418	6.3e-23	PFAM
FN3	535	618	4.93e-1	SMART
FN3	641	721	3.25e1	SMART
FN3	736	818	2.35e0	SMART
transmembrane domain	838	860	N/A	INTRINSIC
low complexity region	908	921	N/A	INTRINSIC
low complexity region	1050	1065	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102777
AA Change: I214V

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000099838
Gene: ENSMUSG00000057722
AA Change: I214V

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
FN3	236	315	1.5e-5	SMART
Pfam:Lep_receptor_Ig	329	420	2.6e-29	PFAM
FN3	535	618	4.93e-1	SMART
FN3	641	721	3.25e1	SMART
FN3	736	818	2.35e0	SMART
transmembrane domain	838	860	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106921
AA Change: I214V

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000102534
Gene: ENSMUSG00000057722
AA Change: I214V

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
FN3	236	315	1.5e-5	SMART
Pfam:Lep_receptor_Ig	329	420	2.6e-29	PFAM
FN3	535	618	4.93e-1	SMART
FN3	641	721	3.25e1	SMART
FN3	736	818	2.35e0	SMART
transmembrane domain	838	860	N/A	INTRINSIC

Meta Mutation Damage Score

0.0806

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

97% (114/118)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous mutants are hyperphagic, low-activity, poorly cold-adapted, sterile and have enhanced fat conversion. They are obese, hyperinsulinemic and, on certain strains, severely hyperglycemic. Heterozygotes are normal but resistant to prolonged fasting. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 117 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	C	A	7: 120,345,998	N432K	possibly damaging	Het
Adamtsl5	G	A	10: 80,344,859	T123I	probably benign	Het
Aff4	T	C	11: 53,372,875	S241P	probably damaging	Het
Agl	A	G	3: 116,758,755	L510P		Het
Aox2	A	T	1: 58,289,983	K196*	probably null	Het
Arhgef37	A	G	18: 61,504,385	L402P	probably damaging	Het
Arid4b	T	C	13: 14,181,306		probably null	Het
Atp5f1	A	G	3: 105,943,802	V193A	probably benign	Het
Atp8b3	A	G	10: 80,529,629		probably null	Het
Baz2a	G	T	10: 128,116,078	R555L	probably damaging	Het
Casp4	G	T	9: 5,321,345	S32I	possibly damaging	Het
Cd300lb	A	G	11: 114,928,302	V167A	probably damaging	Het
Cdc42bpg	C	T	19: 6,318,398	T1042I	probably damaging	Het
Ceacam20	T	C	7: 19,970,234	F70S	probably damaging	Het
Cep162	C	T	9: 87,192,766	V1388I	probably damaging	Het
Cfap65	A	G	1: 74,920,426	V855A	possibly damaging	Het
Chil3	G	T	3: 106,155,706	D189E	probably benign	Het
Cln3	A	G	7: 126,581,740	I43T	probably benign	Het
Cntnap5a	A	G	1: 116,442,380	Q909R	probably benign	Het
Ctsd	C	A	7: 142,383,541	A77S	probably damaging	Het
Dnah12	T	A	14: 26,724,626	S781T	probably benign	Het
Dnah17	T	A	11: 118,090,717	Q1716L	probably null	Het
Dock3	C	A	9: 106,895,583	M490I	probably benign	Het
Erg	T	C	16: 95,459,156		probably null	Het
Fam206a	A	G	4: 56,804,230	I82V	probably null	Het
Farp2	A	T	1: 93,621,228	M1019L	possibly damaging	Het
Fcgbp	A	G	7: 28,086,524	K462R	probably benign	Het
Fn1	A	T	1: 71,649,225	N173K	probably damaging	Het
Fsip2	A	T	2: 82,980,097	L2253F	probably damaging	Het
Gabrd	C	T	4: 155,385,513	R413H	possibly damaging	Het
Galnt5	A	T	2: 58,017,139	D538V	probably damaging	Het
Gje1	T	A	10: 14,716,479	L186F	probably damaging	Het
Gm16686	A	T	4: 88,755,326	C89S	unknown	Het
Gna15	G	T	10: 81,502,997	A336E	probably benign	Het
Golga4	C	T	9: 118,559,495	S1895L	probably benign	Het
Gon4l	A	T	3: 88,907,522	M1933L	probably benign	Het
Gpr183	T	C	14: 121,954,744	S122G	possibly damaging	Het
Gtf2h4	G	A	17: 35,669,358	T348I	probably damaging	Het
Hace1	T	C	10: 45,605,540	Y120H	probably damaging	Het
Hivep2	C	T	10: 14,131,317	H1220Y	possibly damaging	Het
Hmx2	T	C	7: 131,554,503	F66S	probably benign	Het
Hoxd12	A	T	2: 74,675,225	S47C	possibly damaging	Het
Hp	C	A	8: 109,575,200		probably null	Het
Idh3a	T	A	9: 54,601,208	D355E	probably benign	Het
Itga2b	A	T	11: 102,456,294	M921K	probably benign	Het
Jcad	A	G	18: 4,675,529	D1097G	probably benign	Het
Kdm5b	A	T	1: 134,595,833	T249S	probably benign	Het
Klhl11	G	T	11: 100,464,352	H214Q	probably benign	Het
L3hypdh	A	T	12: 72,084,931	Y76N	probably damaging	Het
Lama4	G	T	10: 39,045,755	R424L	possibly damaging	Het
Lipc	G	T	9: 70,802,168	N432K	probably benign	Het
Lipm	C	T	19: 34,116,198	A216V	possibly damaging	Het
Lrrc23	A	G	6: 124,779,125	S2P	unknown	Het
Lyst	T	A	13: 13,637,524	D840E	probably benign	Het
Mmp23	T	A	4: 155,651,584	T204S	probably damaging	Het
Mms19	T	C	19: 41,948,278	T785A	probably benign	Het
Mov10	A	T	3: 104,800,052		probably null	Het
Mtf2	A	G	5: 108,100,970	T383A	probably benign	Het
Myo5c	G	A	9: 75,251,527		probably null	Het
Nfxl1	A	T	5: 72,524,174	C671*	probably null	Het
Npepps	A	G	11: 97,213,156	V813A	probably benign	Het
Nrn1	C	A	13: 36,726,851	W69L	probably damaging	Het
Olfr231	A	C	1: 174,117,187	F276L	probably benign	Het
Olfr543	A	T	7: 102,477,676	Y65N	probably damaging	Het
Olfr656	C	T	7: 104,617,852	H58Y	probably damaging	Het
Olfr663	T	A	7: 104,703,589	D7E	probably benign	Het
Olfr694	T	A	7: 106,689,210	I174F	possibly damaging	Het
Olfr771	A	G	10: 129,160,751	Y78H	possibly damaging	Het
Olfr799	T	C	10: 129,647,158	I10T	probably damaging	Het
Oprd1	A	C	4: 132,114,067	D193E	probably benign	Het
Pcdhac1	G	T	18: 37,092,497	V788L	probably benign	Het
Pcdhb11	G	A	18: 37,423,260	V548M	probably damaging	Het
Pde4c	A	T	8: 70,748,972	E517V	possibly damaging	Het
Pdzd7	T	C	19: 45,033,647	R521G	possibly damaging	Het
Pik3c2a	T	A	7: 116,372,854	K780N	probably damaging	Het
Plb1	T	G	5: 32,321,247		probably null	Het
Plcb4	T	A	2: 136,000,219	L1041Q	probably benign	Het
Pnpla6	G	A	8: 3,516,540		probably null	Het
Ppat	A	T	5: 76,915,979	N441K	probably damaging	Het
Ppp1r1b	G	A	11: 98,355,479	A132T	probably damaging	Het
Prl2c2	A	C	13: 12,997,480		probably null	Het
Prr14	T	C	7: 127,475,286	I330T	probably benign	Het
Pycr1	T	C	11: 120,642,923	D36G	probably benign	Het
Rabep2	T	A	7: 126,438,719	I221N	probably damaging	Het
Rad23b	A	G	4: 55,370,469	D165G	probably benign	Het
Reln	G	A	5: 21,971,953	T1905I	probably damaging	Het
Ripor2	T	C	13: 24,694,205	V321A	probably benign	Het
Rnf43	A	G	11: 87,731,852	D466G	probably benign	Het
Rpl6	A	T	5: 121,205,592	R63W	possibly damaging	Het
S100a14	A	G	3: 90,528,204	T102A	probably benign	Het
Samd11	C	A	4: 156,249,400	V195L	probably benign	Het
Scaper	G	A	9: 55,762,277	Q372*	probably null	Het
Sec14l5	G	T	16: 5,180,875	C593F	probably damaging	Het
Sema6d	T	C	2: 124,654,158	Y41H	probably damaging	Het
Serac1	G	A	17: 6,069,314	R114W	probably damaging	Het
Slc12a4	T	C	8: 105,950,836	E388G	probably benign	Het
Smarcd3	T	C	5: 24,595,812	T164A	probably benign	Het
Smtn	C	A	11: 3,530,249	R324L	probably benign	Het
Spata31d1c	C	T	13: 65,035,361	P239L	probably benign	Het
Srcap	T	C	7: 127,538,517	V1013A	possibly damaging	Het
Sv2b	T	C	7: 75,124,064	N553S	probably damaging	Het
Tex35	T	A	1: 157,105,086	N52I	probably damaging	Het
Ticrr	T	C	7: 79,693,986	S1200P	probably benign	Het
Tmem19	A	G	10: 115,347,699	L125P	probably damaging	Het
Trio	A	G	15: 27,856,107	V666A	probably benign	Het
Ttn	T	C	2: 76,917,283	D4474G	probably benign	Het
Usp43	A	T	11: 67,893,016	S368T	possibly damaging	Het
Vmn2r72	T	A	7: 85,751,140	M234L	probably benign	Het
Wdr93	T	A	7: 79,777,307		probably null	Het
Wrap73	T	A	4: 154,156,127	W359R	probably damaging	Het
Ywhah	A	G	5: 33,026,641	I63V	probably benign	Het
Zbtb7b	G	T	3: 89,381,059	P151T	probably damaging	Het
Zfp318	A	G	17: 46,400,069	N906S	probably damaging	Het
Zfp423	C	A	8: 87,780,713	C1001F	probably damaging	Het
Zmym1	A	G	4: 127,049,398	I399T	possibly damaging	Het
Zmynd15	G	A	11: 70,462,188	G296D	probably benign	Het
Znfx1	T	A	2: 167,048,555	I670F	probably damaging	Het

Other mutations in Lepr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Lepr	APN	4	101815035	missense	probably benign
IGL01111:Lepr	APN	4	101814655	missense	possibly damaging	0.77
IGL01324:Lepr	APN	4	101768068	missense	probably benign	0.23
IGL01372:Lepr	APN	4	101735577	missense	possibly damaging	0.67
IGL01626:Lepr	APN	4	101733534	missense	probably benign	0.10
IGL01733:Lepr	APN	4	101765082	missense	probably benign	0.00
IGL01815:Lepr	APN	4	101814790	missense	possibly damaging	0.49
IGL01899:Lepr	APN	4	101779987	missense	possibly damaging	0.86
IGL02138:Lepr	APN	4	101768067	missense	probably damaging	0.98
IGL02161:Lepr	APN	4	101745678	missense	probably damaging	0.97
IGL02653:Lepr	APN	4	101764944	missense	probably benign	0.44
IGL02735:Lepr	APN	4	101782638	missense	probably damaging	1.00
IGL03035:Lepr	APN	4	101764980	missense	probably damaging	1.00
IGL03083:Lepr	APN	4	101814679	nonsense	probably null
IGL03160:Lepr	APN	4	101764906	missense	probably damaging	1.00
aufsetzigen	UTSW	4	101752175	missense	probably damaging	1.00
business_class	UTSW	4	101764872	missense	probably damaging	1.00
cherub	UTSW	4	101768063	missense	probably benign	0.25
clodhopper	UTSW	4	101765290	splice site	probably null
donner	UTSW	4	101815201	missense	probably damaging	1.00
fluffy	UTSW	4	101792023	missense	probably damaging	1.00
giant	UTSW	4	101765152	critical splice donor site	probably null
gordo	UTSW	4	101765305	missense	probably damaging	0.97
Immunoglutton	UTSW	4	101765301	splice site	probably benign
Jumbo_shrimp	UTSW	4	101764954	nonsense	probably null
lowleaning	UTSW	4	101814391	splice site	probably null
odd	UTSW	4	101728075	splice site	probably benign
paleo	UTSW	4	101745645	missense	possibly damaging	0.94
R0140_Lepr_245	UTSW	4	101768067	missense	probably damaging	1.00
well-upholstered	UTSW	4	101772959	synonymous	probably benign
worldly	UTSW	4	101768228	missense	possibly damaging	0.96
PIT4651001:Lepr	UTSW	4	101791997	missense	probably damaging	1.00
PIT4696001:Lepr	UTSW	4	101779983	missense	probably benign	0.10
R0140:Lepr	UTSW	4	101768067	missense	probably damaging	1.00
R0197:Lepr	UTSW	4	101752152	missense	possibly damaging	0.64
R0279:Lepr	UTSW	4	101750344	missense	probably benign	0.05
R0487:Lepr	UTSW	4	101768093	nonsense	probably null
R0498:Lepr	UTSW	4	101745692	missense	probably benign	0.01
R0506:Lepr	UTSW	4	101773010	splice site	probably benign
R0512:Lepr	UTSW	4	101792019	missense	probably damaging	1.00
R0512:Lepr	UTSW	4	101814704	missense	possibly damaging	0.87
R0726:Lepr	UTSW	4	101764934	missense	probably benign	0.01
R1054:Lepr	UTSW	4	101782596	missense	probably damaging	0.97
R1109:Lepr	UTSW	4	101771355	missense	probably damaging	1.00
R1398:Lepr	UTSW	4	101792019	missense	probably damaging	1.00
R1464:Lepr	UTSW	4	101735681	missense	probably benign	0.08
R1464:Lepr	UTSW	4	101735681	missense	probably benign	0.08
R1519:Lepr	UTSW	4	101789344	missense	probably damaging	0.97
R1602:Lepr	UTSW	4	101745645	missense	possibly damaging	0.94
R1830:Lepr	UTSW	4	101735677	missense	probably damaging	1.00
R1850:Lepr	UTSW	4	101733423	missense	possibly damaging	0.67
R1918:Lepr	UTSW	4	101772836	missense	probably benign	0.08
R1928:Lepr	UTSW	4	101782730	splice site	probably benign
R2099:Lepr	UTSW	4	101772988	missense	probably damaging	1.00
R2102:Lepr	UTSW	4	101772981	missense	possibly damaging	0.95
R2175:Lepr	UTSW	4	101765379	missense	probably benign	0.01
R2254:Lepr	UTSW	4	101815112	missense	probably benign	0.26
R2396:Lepr	UTSW	4	101733528	missense	probably benign	0.19
R2508:Lepr	UTSW	4	101790896	missense	probably damaging	0.98
R2571:Lepr	UTSW	4	101768172	missense	possibly damaging	0.96
R3790:Lepr	UTSW	4	101790914	splice site	probably benign
R3882:Lepr	UTSW	4	101815265	missense	probably damaging	1.00
R3933:Lepr	UTSW	4	101765301	splice site	probably benign
R4211:Lepr	UTSW	4	101733414	missense	probably benign	0.19
R4343:Lepr	UTSW	4	101765152	critical splice donor site	probably null
R4345:Lepr	UTSW	4	101765152	critical splice donor site	probably null
R4544:Lepr	UTSW	4	101768228	missense	possibly damaging	0.96
R4546:Lepr	UTSW	4	101814641	missense	probably benign	0.35
R4724:Lepr	UTSW	4	101765365	nonsense	probably null
R4797:Lepr	UTSW	4	101780047	missense	possibly damaging	0.90
R4860:Lepr	UTSW	4	101789337	missense	probably benign	0.14
R4860:Lepr	UTSW	4	101789337	missense	probably benign	0.14
R4929:Lepr	UTSW	4	101815117	missense	probably benign	0.00
R4939:Lepr	UTSW	4	101733438	missense	possibly damaging	0.78
R5377:Lepr	UTSW	4	101815019	missense	possibly damaging	0.71
R5520:Lepr	UTSW	4	101745537	missense	probably benign	0.00
R5966:Lepr	UTSW	4	101792127	intron	probably benign
R6092:Lepr	UTSW	4	101792023	missense	probably damaging	1.00
R6130:Lepr	UTSW	4	101765372	missense	probably damaging	0.99
R6168:Lepr	UTSW	4	101735592	missense	probably damaging	0.99
R6232:Lepr	UTSW	4	101814391	splice site	probably null
R6380:Lepr	UTSW	4	101764954	nonsense	probably null
R6427:Lepr	UTSW	4	101774257	missense	possibly damaging	0.47
R6428:Lepr	UTSW	4	101780098	missense	probably damaging	1.00
R6641:Lepr	UTSW	4	101765305	missense	probably damaging	0.97
R6650:Lepr	UTSW	4	101815201	missense	probably damaging	1.00
R6859:Lepr	UTSW	4	101765290	splice site	probably null
R7023:Lepr	UTSW	4	101789287	missense	probably damaging	1.00
R7145:Lepr	UTSW	4	101752197	missense	probably benign	0.00
R7174:Lepr	UTSW	4	101750338	missense	probably benign	0.01
R7179:Lepr	UTSW	4	101745659	missense	probably benign	0.06
R7189:Lepr	UTSW	4	101814764	missense	probably benign	0.00
R7531:Lepr	UTSW	4	101752175	missense	probably damaging	1.00
R7620:Lepr	UTSW	4	101752073	missense	probably benign	0.41
R7804:Lepr	UTSW	4	101782586	missense	probably damaging	1.00
R8022:Lepr	UTSW	4	101782557	missense	probably benign	0.32
R8142:Lepr	UTSW	4	101765419	missense	possibly damaging	0.93
R8227:Lepr	UTSW	4	101771362	missense	probably damaging	0.99
R8426:Lepr	UTSW	4	101814644	missense	probably benign	0.12
R8447:Lepr	UTSW	4	101814491	missense	probably benign	0.08
R8531:Lepr	UTSW	4	101765415	missense	probably damaging	1.00
R8682:Lepr	UTSW	4	101792072	missense	probably benign	0.00
R8897:Lepr	UTSW	4	101792036	missense	probably damaging	0.98
R9096:Lepr	UTSW	4	101774221	missense	possibly damaging	0.95
R9177:Lepr	UTSW	4	101745601	nonsense	probably null
R9241:Lepr	UTSW	4	101814591	missense	probably benign
X0026:Lepr	UTSW	4	101733327	missense	possibly damaging	0.47
Z1176:Lepr	UTSW	4	101745614	missense	probably damaging	0.99
Z1177:Lepr	UTSW	4	101735595	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGGCAGTGGCTTCTCTTTC -3'
(R):5'- TGATCACAGTGATGTAAGCCAG -3'

Sequencing Primer
(F):5'- GCTTATGCTACCTTGACAGTCAG -3'
(R):5'- TTACCAACAAGCATGGGC -3'

Posted On

2019-10-07