Incidental Mutation 'R7426:Lepr'
ID576053
Institutional Source Beutler Lab
Gene Symbol Lepr
Ensembl Gene ENSMUSG00000057722
Gene Nameleptin receptor
Synonymsobl, Leprb, Obr, obese-like, OB-RGRP, Modb1, leptin receptor gene-related protein, LEPROT
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7426 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location101717404-101815352 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101745656 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 214 (I214V)
Ref Sequence ENSEMBL: ENSMUSP00000037385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037552] [ENSMUST00000102777] [ENSMUST00000106921]
Predicted Effect probably benign
Transcript: ENSMUST00000037552
AA Change: I214V

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000037385
Gene: ENSMUSG00000057722
AA Change: I214V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 328 418 6.3e-23 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
low complexity region 908 921 N/A INTRINSIC
low complexity region 1050 1065 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102777
AA Change: I214V

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000099838
Gene: ENSMUSG00000057722
AA Change: I214V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 329 420 2.6e-29 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106921
AA Change: I214V

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000102534
Gene: ENSMUSG00000057722
AA Change: I214V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 329 420 2.6e-29 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
Meta Mutation Damage Score 0.0806 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (114/118)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous mutants are hyperphagic, low-activity, poorly cold-adapted, sterile and have enhanced fat conversion. They are obese, hyperinsulinemic and, on certain strains, severely hyperglycemic. Heterozygotes are normal but resistant to prolonged fasting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 C A 7: 120,345,998 N432K possibly damaging Het
Adamtsl5 G A 10: 80,344,859 T123I probably benign Het
Aff4 T C 11: 53,372,875 S241P probably damaging Het
Agl A G 3: 116,758,755 L510P Het
Aox2 A T 1: 58,289,983 K196* probably null Het
Arhgef37 A G 18: 61,504,385 L402P probably damaging Het
Arid4b T C 13: 14,181,306 probably null Het
Atp5f1 A G 3: 105,943,802 V193A probably benign Het
Atp8b3 A G 10: 80,529,629 probably null Het
Baz2a G T 10: 128,116,078 R555L probably damaging Het
Casp4 G T 9: 5,321,345 S32I possibly damaging Het
Cd300lb A G 11: 114,928,302 V167A probably damaging Het
Cdc42bpg C T 19: 6,318,398 T1042I probably damaging Het
Ceacam20 T C 7: 19,970,234 F70S probably damaging Het
Cep162 C T 9: 87,192,766 V1388I probably damaging Het
Cfap65 A G 1: 74,920,426 V855A possibly damaging Het
Chil3 G T 3: 106,155,706 D189E probably benign Het
Cln3 A G 7: 126,581,740 I43T probably benign Het
Cntnap5a A G 1: 116,442,380 Q909R probably benign Het
Ctsd C A 7: 142,383,541 A77S probably damaging Het
Dnah12 T A 14: 26,724,626 S781T probably benign Het
Dnah17 T A 11: 118,090,717 Q1716L probably null Het
Dock3 C A 9: 106,895,583 M490I probably benign Het
Erg T C 16: 95,459,156 probably null Het
Fam206a A G 4: 56,804,230 I82V probably null Het
Farp2 A T 1: 93,621,228 M1019L possibly damaging Het
Fcgbp A G 7: 28,086,524 K462R probably benign Het
Fn1 A T 1: 71,649,225 N173K probably damaging Het
Fsip2 A T 2: 82,980,097 L2253F probably damaging Het
Gabrd C T 4: 155,385,513 R413H possibly damaging Het
Galnt5 A T 2: 58,017,139 D538V probably damaging Het
Gje1 T A 10: 14,716,479 L186F probably damaging Het
Gm16686 A T 4: 88,755,326 C89S unknown Het
Gna15 G T 10: 81,502,997 A336E probably benign Het
Golga4 C T 9: 118,559,495 S1895L probably benign Het
Gon4l A T 3: 88,907,522 M1933L probably benign Het
Gpr183 T C 14: 121,954,744 S122G possibly damaging Het
Gtf2h4 G A 17: 35,669,358 T348I probably damaging Het
Hace1 T C 10: 45,605,540 Y120H probably damaging Het
Hivep2 C T 10: 14,131,317 H1220Y possibly damaging Het
Hmx2 T C 7: 131,554,503 F66S probably benign Het
Hoxd12 A T 2: 74,675,225 S47C possibly damaging Het
Hp C A 8: 109,575,200 probably null Het
Idh3a T A 9: 54,601,208 D355E probably benign Het
Itga2b A T 11: 102,456,294 M921K probably benign Het
Jcad A G 18: 4,675,529 D1097G probably benign Het
Kdm5b A T 1: 134,595,833 T249S probably benign Het
Klhl11 G T 11: 100,464,352 H214Q probably benign Het
L3hypdh A T 12: 72,084,931 Y76N probably damaging Het
Lama4 G T 10: 39,045,755 R424L possibly damaging Het
Lipc G T 9: 70,802,168 N432K probably benign Het
Lipm C T 19: 34,116,198 A216V possibly damaging Het
Lrrc23 A G 6: 124,779,125 S2P unknown Het
Lyst T A 13: 13,637,524 D840E probably benign Het
Mmp23 T A 4: 155,651,584 T204S probably damaging Het
Mms19 T C 19: 41,948,278 T785A probably benign Het
Mov10 A T 3: 104,800,052 probably null Het
Mtf2 A G 5: 108,100,970 T383A probably benign Het
Myo5c G A 9: 75,251,527 probably null Het
Nfxl1 A T 5: 72,524,174 C671* probably null Het
Npepps A G 11: 97,213,156 V813A probably benign Het
Nrn1 C A 13: 36,726,851 W69L probably damaging Het
Olfr231 A C 1: 174,117,187 F276L probably benign Het
Olfr543 A T 7: 102,477,676 Y65N probably damaging Het
Olfr656 C T 7: 104,617,852 H58Y probably damaging Het
Olfr663 T A 7: 104,703,589 D7E probably benign Het
Olfr694 T A 7: 106,689,210 I174F possibly damaging Het
Olfr771 A G 10: 129,160,751 Y78H possibly damaging Het
Olfr799 T C 10: 129,647,158 I10T probably damaging Het
Oprd1 A C 4: 132,114,067 D193E probably benign Het
Pcdhac1 G T 18: 37,092,497 V788L probably benign Het
Pcdhb11 G A 18: 37,423,260 V548M probably damaging Het
Pde4c A T 8: 70,748,972 E517V possibly damaging Het
Pdzd7 T C 19: 45,033,647 R521G possibly damaging Het
Pik3c2a T A 7: 116,372,854 K780N probably damaging Het
Plb1 T G 5: 32,321,247 probably null Het
Plcb4 T A 2: 136,000,219 L1041Q probably benign Het
Pnpla6 G A 8: 3,516,540 probably null Het
Ppat A T 5: 76,915,979 N441K probably damaging Het
Ppp1r1b G A 11: 98,355,479 A132T probably damaging Het
Prl2c2 A C 13: 12,997,480 probably null Het
Prr14 T C 7: 127,475,286 I330T probably benign Het
Pycr1 T C 11: 120,642,923 D36G probably benign Het
Rabep2 T A 7: 126,438,719 I221N probably damaging Het
Rad23b A G 4: 55,370,469 D165G probably benign Het
Reln G A 5: 21,971,953 T1905I probably damaging Het
Ripor2 T C 13: 24,694,205 V321A probably benign Het
Rnf43 A G 11: 87,731,852 D466G probably benign Het
Rpl6 A T 5: 121,205,592 R63W possibly damaging Het
S100a14 A G 3: 90,528,204 T102A probably benign Het
Samd11 C A 4: 156,249,400 V195L probably benign Het
Scaper G A 9: 55,762,277 Q372* probably null Het
Sec14l5 G T 16: 5,180,875 C593F probably damaging Het
Sema6d T C 2: 124,654,158 Y41H probably damaging Het
Serac1 G A 17: 6,069,314 R114W probably damaging Het
Slc12a4 T C 8: 105,950,836 E388G probably benign Het
Smarcd3 T C 5: 24,595,812 T164A probably benign Het
Smtn C A 11: 3,530,249 R324L probably benign Het
Spata31d1c C T 13: 65,035,361 P239L probably benign Het
Srcap T C 7: 127,538,517 V1013A possibly damaging Het
Sv2b T C 7: 75,124,064 N553S probably damaging Het
Tex35 T A 1: 157,105,086 N52I probably damaging Het
Ticrr T C 7: 79,693,986 S1200P probably benign Het
Tmem19 A G 10: 115,347,699 L125P probably damaging Het
Trio A G 15: 27,856,107 V666A probably benign Het
Ttn T C 2: 76,917,283 D4474G probably benign Het
Usp43 A T 11: 67,893,016 S368T possibly damaging Het
Vmn2r72 T A 7: 85,751,140 M234L probably benign Het
Wdr93 T A 7: 79,777,307 probably null Het
Wrap73 T A 4: 154,156,127 W359R probably damaging Het
Ywhah A G 5: 33,026,641 I63V probably benign Het
Zbtb7b G T 3: 89,381,059 P151T probably damaging Het
Zfp318 A G 17: 46,400,069 N906S probably damaging Het
Zfp423 C A 8: 87,780,713 C1001F probably damaging Het
Zmym1 A G 4: 127,049,398 I399T possibly damaging Het
Zmynd15 G A 11: 70,462,188 G296D probably benign Het
Znfx1 T A 2: 167,048,555 I670F probably damaging Het
Other mutations in Lepr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Lepr APN 4 101815035 missense probably benign
IGL01111:Lepr APN 4 101814655 missense possibly damaging 0.77
IGL01324:Lepr APN 4 101768068 missense probably benign 0.23
IGL01372:Lepr APN 4 101735577 missense possibly damaging 0.67
IGL01626:Lepr APN 4 101733534 missense probably benign 0.10
IGL01733:Lepr APN 4 101765082 missense probably benign 0.00
IGL01815:Lepr APN 4 101814790 missense possibly damaging 0.49
IGL01899:Lepr APN 4 101779987 missense possibly damaging 0.86
IGL02138:Lepr APN 4 101768067 missense probably damaging 0.98
IGL02161:Lepr APN 4 101745678 missense probably damaging 0.97
IGL02653:Lepr APN 4 101764944 missense probably benign 0.44
IGL02735:Lepr APN 4 101782638 missense probably damaging 1.00
IGL03035:Lepr APN 4 101764980 missense probably damaging 1.00
IGL03083:Lepr APN 4 101814679 nonsense probably null
IGL03160:Lepr APN 4 101764906 missense probably damaging 1.00
aufsetzigen UTSW 4 101752175 missense probably damaging 1.00
business_class UTSW 4 101764872 missense probably damaging 1.00
cherub UTSW 4 101768063 missense probably benign 0.25
clodhopper UTSW 4 101765290 splice site probably null
donner UTSW 4 101815201 missense probably damaging 1.00
fluffy UTSW 4 101792023 missense probably damaging 1.00
giant UTSW 4 101765152 critical splice donor site probably null
gordo UTSW 4 101765305 missense probably damaging 0.97
Immunoglutton UTSW 4 101765301 splice site probably benign
Jumbo_shrimp UTSW 4 101764954 nonsense probably null
lowleaning UTSW 4 101814391 splice site probably null
odd UTSW 4 101728075 splice site probably benign
paleo UTSW 4 101745645 missense possibly damaging 0.94
well-upholstered UTSW 4 101772959 synonymous probably benign
worldly UTSW 4 101768228 missense possibly damaging 0.96
PIT4651001:Lepr UTSW 4 101791997 missense probably damaging 1.00
PIT4696001:Lepr UTSW 4 101779983 missense probably benign 0.10
R0140:Lepr UTSW 4 101768067 missense probably damaging 1.00
R0197:Lepr UTSW 4 101752152 missense possibly damaging 0.64
R0279:Lepr UTSW 4 101750344 missense probably benign 0.05
R0487:Lepr UTSW 4 101768093 nonsense probably null
R0498:Lepr UTSW 4 101745692 missense probably benign 0.01
R0506:Lepr UTSW 4 101773010 splice site probably benign
R0512:Lepr UTSW 4 101792019 missense probably damaging 1.00
R0512:Lepr UTSW 4 101814704 missense possibly damaging 0.87
R0726:Lepr UTSW 4 101764934 missense probably benign 0.01
R1054:Lepr UTSW 4 101782596 missense probably damaging 0.97
R1109:Lepr UTSW 4 101771355 missense probably damaging 1.00
R1398:Lepr UTSW 4 101792019 missense probably damaging 1.00
R1464:Lepr UTSW 4 101735681 missense probably benign 0.08
R1464:Lepr UTSW 4 101735681 missense probably benign 0.08
R1519:Lepr UTSW 4 101789344 missense probably damaging 0.97
R1602:Lepr UTSW 4 101745645 missense possibly damaging 0.94
R1830:Lepr UTSW 4 101735677 missense probably damaging 1.00
R1850:Lepr UTSW 4 101733423 missense possibly damaging 0.67
R1918:Lepr UTSW 4 101772836 missense probably benign 0.08
R1928:Lepr UTSW 4 101782730 splice site probably benign
R2099:Lepr UTSW 4 101772988 missense probably damaging 1.00
R2102:Lepr UTSW 4 101772981 missense possibly damaging 0.95
R2175:Lepr UTSW 4 101765379 missense probably benign 0.01
R2254:Lepr UTSW 4 101815112 missense probably benign 0.26
R2396:Lepr UTSW 4 101733528 missense probably benign 0.19
R2508:Lepr UTSW 4 101790896 missense probably damaging 0.98
R2571:Lepr UTSW 4 101768172 missense possibly damaging 0.96
R3790:Lepr UTSW 4 101790914 splice site probably benign
R3882:Lepr UTSW 4 101815265 missense probably damaging 1.00
R3933:Lepr UTSW 4 101765301 splice site probably benign
R4211:Lepr UTSW 4 101733414 missense probably benign 0.19
R4343:Lepr UTSW 4 101765152 critical splice donor site probably null
R4345:Lepr UTSW 4 101765152 critical splice donor site probably null
R4544:Lepr UTSW 4 101768228 missense possibly damaging 0.96
R4546:Lepr UTSW 4 101814641 missense probably benign 0.35
R4724:Lepr UTSW 4 101765365 nonsense probably null
R4797:Lepr UTSW 4 101780047 missense possibly damaging 0.90
R4860:Lepr UTSW 4 101789337 missense probably benign 0.14
R4860:Lepr UTSW 4 101789337 missense probably benign 0.14
R4929:Lepr UTSW 4 101815117 missense probably benign 0.00
R4939:Lepr UTSW 4 101733438 missense possibly damaging 0.78
R5377:Lepr UTSW 4 101815019 missense possibly damaging 0.71
R5520:Lepr UTSW 4 101745537 missense probably benign 0.00
R5966:Lepr UTSW 4 101792127 intron probably benign
R6092:Lepr UTSW 4 101792023 missense probably damaging 1.00
R6130:Lepr UTSW 4 101765372 missense probably damaging 0.99
R6168:Lepr UTSW 4 101735592 missense probably damaging 0.99
R6232:Lepr UTSW 4 101814391 splice site probably null
R6380:Lepr UTSW 4 101764954 nonsense probably null
R6427:Lepr UTSW 4 101774257 missense possibly damaging 0.47
R6428:Lepr UTSW 4 101780098 missense probably damaging 1.00
R6641:Lepr UTSW 4 101765305 missense probably damaging 0.97
R6650:Lepr UTSW 4 101815201 missense probably damaging 1.00
R6859:Lepr UTSW 4 101765290 splice site probably null
R7023:Lepr UTSW 4 101789287 missense probably damaging 1.00
R7145:Lepr UTSW 4 101752197 missense probably benign 0.00
R7174:Lepr UTSW 4 101750338 missense probably benign 0.01
R7179:Lepr UTSW 4 101745659 missense probably benign 0.06
R7189:Lepr UTSW 4 101814764 missense probably benign 0.00
R7531:Lepr UTSW 4 101752175 missense probably damaging 1.00
R7620:Lepr UTSW 4 101752073 missense probably benign 0.41
R7804:Lepr UTSW 4 101782586 missense probably damaging 1.00
R8022:Lepr UTSW 4 101782557 missense probably benign 0.32
R8142:Lepr UTSW 4 101765419 missense possibly damaging 0.93
R8227:Lepr UTSW 4 101771362 missense probably damaging 0.99
R8426:Lepr UTSW 4 101814644 missense probably benign 0.12
R8447:Lepr UTSW 4 101814491 missense probably benign 0.08
R8531:Lepr UTSW 4 101765415 missense probably damaging 1.00
R8682:Lepr UTSW 4 101792072 missense probably benign 0.00
X0026:Lepr UTSW 4 101733327 missense possibly damaging 0.47
Z1176:Lepr UTSW 4 101745614 missense probably damaging 0.99
Z1177:Lepr UTSW 4 101735595 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCAGTGGCTTCTCTTTC -3'
(R):5'- TGATCACAGTGATGTAAGCCAG -3'

Sequencing Primer
(F):5'- GCTTATGCTACCTTGACAGTCAG -3'
(R):5'- TTACCAACAAGCATGGGC -3'
Posted On2019-10-07