Incidental Mutation 'R7426:Ticrr'
ID 576071
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene Name TOPBP1-interacting checkpoint and replication regulator
Synonyms 5730590G19Rik
MMRRC Submission 045504-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R7426 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 79309944-79347896 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 79343734 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1200 (S1200P)
Ref Sequence ENSEMBL: ENSMUSP00000041377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000059836] [ENSMUST00000178048] [ENSMUST00000183846] [ENSMUST00000184137] [ENSMUST00000206591] [ENSMUST00000206622]
AlphaFold Q8BQ33
Predicted Effect probably benign
Transcript: ENSMUST00000035977
AA Change: S1200P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: S1200P

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000059836
SMART Domains Protein: ENSMUSP00000061806
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 927 944 N/A INTRINSIC
low complexity region 979 993 N/A INTRINSIC
low complexity region 1049 1061 N/A INTRINSIC
coiled coil region 1113 1139 N/A INTRINSIC
coiled coil region 1186 1205 N/A INTRINSIC
low complexity region 1293 1304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178048
SMART Domains Protein: ENSMUSP00000136993
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 908 918 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
coiled coil region 1114 1140 N/A INTRINSIC
coiled coil region 1187 1206 N/A INTRINSIC
low complexity region 1294 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183846
SMART Domains Protein: ENSMUSP00000139359
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 908 918 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
coiled coil region 1114 1140 N/A INTRINSIC
coiled coil region 1187 1206 N/A INTRINSIC
low complexity region 1294 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184137
SMART Domains Protein: ENSMUSP00000139224
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 927 944 N/A INTRINSIC
low complexity region 979 993 N/A INTRINSIC
low complexity region 1049 1061 N/A INTRINSIC
coiled coil region 1113 1139 N/A INTRINSIC
coiled coil region 1186 1205 N/A INTRINSIC
low complexity region 1293 1304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206591
Predicted Effect probably benign
Transcript: ENSMUST00000206622
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (114/118)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 C A 7: 119,945,221 (GRCm39) N432K possibly damaging Het
Abitram A G 4: 56,804,230 (GRCm39) I82V probably null Het
Adamtsl5 G A 10: 80,180,693 (GRCm39) T123I probably benign Het
Aff4 T C 11: 53,263,702 (GRCm39) S241P probably damaging Het
Agl A G 3: 116,552,404 (GRCm39) L510P Het
Aox1 A T 1: 58,329,142 (GRCm39) K196* probably null Het
Arhgef37 A G 18: 61,637,456 (GRCm39) L402P probably damaging Het
Arid4b T C 13: 14,355,891 (GRCm39) probably null Het
Atp5pb A G 3: 105,851,118 (GRCm39) V193A probably benign Het
Atp8b3 A G 10: 80,365,463 (GRCm39) probably null Het
Baz2a G T 10: 127,951,947 (GRCm39) R555L probably damaging Het
Casp4 G T 9: 5,321,345 (GRCm39) S32I possibly damaging Het
Cd300lb A G 11: 114,819,128 (GRCm39) V167A probably damaging Het
Cdc42bpg C T 19: 6,368,428 (GRCm39) T1042I probably damaging Het
Ceacam20 T C 7: 19,704,159 (GRCm39) F70S probably damaging Het
Cep162 C T 9: 87,074,819 (GRCm39) V1388I probably damaging Het
Cfap65 A G 1: 74,959,585 (GRCm39) V855A possibly damaging Het
Chil3 G T 3: 106,063,022 (GRCm39) D189E probably benign Het
Cln3 A G 7: 126,180,912 (GRCm39) I43T probably benign Het
Cntnap5a A G 1: 116,370,110 (GRCm39) Q909R probably benign Het
Ctsd C A 7: 141,937,278 (GRCm39) A77S probably damaging Het
Dnah12 T A 14: 26,445,781 (GRCm39) S781T probably benign Het
Dnah17 T A 11: 117,981,543 (GRCm39) Q1716L probably null Het
Dock3 C A 9: 106,772,782 (GRCm39) M490I probably benign Het
Erg T C 16: 95,260,015 (GRCm39) probably null Het
Farp2 A T 1: 93,548,950 (GRCm39) M1019L possibly damaging Het
Fcgbp A G 7: 27,785,949 (GRCm39) K462R probably benign Het
Fn1 A T 1: 71,688,384 (GRCm39) N173K probably damaging Het
Fsip2 A T 2: 82,810,441 (GRCm39) L2253F probably damaging Het
Gabrd C T 4: 155,469,970 (GRCm39) R413H possibly damaging Het
Galnt5 A T 2: 57,907,151 (GRCm39) D538V probably damaging Het
Gje1 T A 10: 14,592,223 (GRCm39) L186F probably damaging Het
Gm16686 A T 4: 88,673,563 (GRCm39) C89S unknown Het
Gna15 G T 10: 81,338,831 (GRCm39) A336E probably benign Het
Golga4 C T 9: 118,388,563 (GRCm39) S1895L probably benign Het
Gon4l A T 3: 88,814,829 (GRCm39) M1933L probably benign Het
Gpr183 T C 14: 122,192,156 (GRCm39) S122G possibly damaging Het
Gtf2h4 G A 17: 35,980,250 (GRCm39) T348I probably damaging Het
Hace1 T C 10: 45,481,636 (GRCm39) Y120H probably damaging Het
Hivep2 C T 10: 14,007,061 (GRCm39) H1220Y possibly damaging Het
Hmx2 T C 7: 131,156,232 (GRCm39) F66S probably benign Het
Hoxd12 A T 2: 74,505,569 (GRCm39) S47C possibly damaging Het
Hp C A 8: 110,301,832 (GRCm39) probably null Het
Idh3a T A 9: 54,508,492 (GRCm39) D355E probably benign Het
Itga2b A T 11: 102,347,120 (GRCm39) M921K probably benign Het
Jcad A G 18: 4,675,529 (GRCm39) D1097G probably benign Het
Kdm5b A T 1: 134,523,571 (GRCm39) T249S probably benign Het
Klhl11 G T 11: 100,355,178 (GRCm39) H214Q probably benign Het
L3hypdh A T 12: 72,131,705 (GRCm39) Y76N probably damaging Het
Lama4 G T 10: 38,921,751 (GRCm39) R424L possibly damaging Het
Lepr A G 4: 101,602,853 (GRCm39) I214V probably benign Het
Lipc G T 9: 70,709,450 (GRCm39) N432K probably benign Het
Lipm C T 19: 34,093,598 (GRCm39) A216V possibly damaging Het
Lrrc23 A G 6: 124,756,088 (GRCm39) S2P unknown Het
Lyst T A 13: 13,812,109 (GRCm39) D840E probably benign Het
Mmp23 T A 4: 155,736,041 (GRCm39) T204S probably damaging Het
Mms19 T C 19: 41,936,717 (GRCm39) T785A probably benign Het
Mov10 A T 3: 104,707,368 (GRCm39) probably null Het
Mtf2 A G 5: 108,248,836 (GRCm39) T383A probably benign Het
Myo5c G A 9: 75,158,809 (GRCm39) probably null Het
Nfxl1 A T 5: 72,681,517 (GRCm39) C671* probably null Het
Npepps A G 11: 97,103,982 (GRCm39) V813A probably benign Het
Nrn1 C A 13: 36,910,825 (GRCm39) W69L probably damaging Het
Oprd1 A C 4: 131,841,378 (GRCm39) D193E probably benign Het
Or2ag1b T A 7: 106,288,417 (GRCm39) I174F possibly damaging Het
Or52p1 C T 7: 104,267,059 (GRCm39) H58Y probably damaging Het
Or55b3 A T 7: 102,126,883 (GRCm39) Y65N probably damaging Het
Or56b2j T A 7: 104,352,796 (GRCm39) D7E probably benign Het
Or6c202 A G 10: 128,996,620 (GRCm39) Y78H possibly damaging Het
Or6c209 T C 10: 129,483,027 (GRCm39) I10T probably damaging Het
Or6k6 A C 1: 173,944,753 (GRCm39) F276L probably benign Het
Pcdhac1 G T 18: 37,225,550 (GRCm39) V788L probably benign Het
Pcdhb11 G A 18: 37,556,313 (GRCm39) V548M probably damaging Het
Pde4c A T 8: 71,201,621 (GRCm39) E517V possibly damaging Het
Pdzd7 T C 19: 45,022,086 (GRCm39) R521G possibly damaging Het
Pik3c2a T A 7: 115,972,089 (GRCm39) K780N probably damaging Het
Plb1 T G 5: 32,478,591 (GRCm39) probably null Het
Plcb4 T A 2: 135,842,139 (GRCm39) L1041Q probably benign Het
Pnpla6 G A 8: 3,566,540 (GRCm39) probably null Het
Ppat A T 5: 77,063,826 (GRCm39) N441K probably damaging Het
Ppp1r1b G A 11: 98,246,305 (GRCm39) A132T probably damaging Het
Prl2c2 A C 13: 13,172,065 (GRCm39) probably null Het
Prr14 T C 7: 127,074,458 (GRCm39) I330T probably benign Het
Pycr1 T C 11: 120,533,749 (GRCm39) D36G probably benign Het
Rabep2 T A 7: 126,037,891 (GRCm39) I221N probably damaging Het
Rad23b A G 4: 55,370,469 (GRCm39) D165G probably benign Het
Reln G A 5: 22,176,951 (GRCm39) T1905I probably damaging Het
Ripor2 T C 13: 24,878,188 (GRCm39) V321A probably benign Het
Rnf43 A G 11: 87,622,678 (GRCm39) D466G probably benign Het
Rpl6 A T 5: 121,343,655 (GRCm39) R63W possibly damaging Het
S100a14 A G 3: 90,435,511 (GRCm39) T102A probably benign Het
Samd11 C A 4: 156,333,857 (GRCm39) V195L probably benign Het
Scaper G A 9: 55,669,561 (GRCm39) Q372* probably null Het
Sec14l5 G T 16: 4,998,739 (GRCm39) C593F probably damaging Het
Sema6d T C 2: 124,496,078 (GRCm39) Y41H probably damaging Het
Serac1 G A 17: 6,119,589 (GRCm39) R114W probably damaging Het
Slc12a4 T C 8: 106,677,468 (GRCm39) E388G probably benign Het
Smarcd3 T C 5: 24,800,810 (GRCm39) T164A probably benign Het
Smtn C A 11: 3,480,249 (GRCm39) R324L probably benign Het
Spata31d1c C T 13: 65,183,175 (GRCm39) P239L probably benign Het
Srcap T C 7: 127,137,689 (GRCm39) V1013A possibly damaging Het
Sv2b T C 7: 74,773,812 (GRCm39) N553S probably damaging Het
Tex35 T A 1: 156,932,656 (GRCm39) N52I probably damaging Het
Tmem19 A G 10: 115,183,604 (GRCm39) L125P probably damaging Het
Trio A G 15: 27,856,193 (GRCm39) V666A probably benign Het
Ttn T C 2: 76,747,627 (GRCm39) D4474G probably benign Het
Usp43 A T 11: 67,783,842 (GRCm39) S368T possibly damaging Het
Vmn2r72 T A 7: 85,400,348 (GRCm39) M234L probably benign Het
Wdr93 T A 7: 79,427,055 (GRCm39) probably null Het
Wrap73 T A 4: 154,240,584 (GRCm39) W359R probably damaging Het
Ywhah A G 5: 33,183,985 (GRCm39) I63V probably benign Het
Zbtb7b G T 3: 89,288,366 (GRCm39) P151T probably damaging Het
Zfp318 A G 17: 46,710,995 (GRCm39) N906S probably damaging Het
Zfp423 C A 8: 88,507,341 (GRCm39) C1001F probably damaging Het
Zmym1 A G 4: 126,943,191 (GRCm39) I399T possibly damaging Het
Zmynd15 G A 11: 70,353,014 (GRCm39) G296D probably benign Het
Znfx1 T A 2: 166,890,475 (GRCm39) I670F probably damaging Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79,327,031 (GRCm39) missense probably damaging 1.00
IGL00596:Ticrr APN 7 79,327,041 (GRCm39) missense probably damaging 1.00
IGL01327:Ticrr APN 7 79,344,209 (GRCm39) missense probably benign 0.00
IGL01525:Ticrr APN 7 79,332,197 (GRCm39) missense probably damaging 1.00
IGL01565:Ticrr APN 7 79,344,296 (GRCm39) missense probably benign
IGL01936:Ticrr APN 7 79,344,297 (GRCm39) missense probably benign 0.11
IGL02160:Ticrr APN 7 79,343,767 (GRCm39) missense probably benign 0.29
IGL02246:Ticrr APN 7 79,325,076 (GRCm39) missense probably damaging 1.00
IGL02487:Ticrr APN 7 79,332,769 (GRCm39) missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79,345,214 (GRCm39) missense probably damaging 0.99
IGL02970:Ticrr APN 7 79,344,919 (GRCm39) missense probably benign 0.01
FR4304:Ticrr UTSW 7 79,344,059 (GRCm39) intron probably benign
PIT4305001:Ticrr UTSW 7 79,328,771 (GRCm39) missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79,319,386 (GRCm39) missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79,343,540 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0362:Ticrr UTSW 7 79,327,088 (GRCm39) missense probably damaging 1.00
R0482:Ticrr UTSW 7 79,344,236 (GRCm39) missense probably damaging 0.99
R0595:Ticrr UTSW 7 79,345,311 (GRCm39) missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1119:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1572:Ticrr UTSW 7 79,331,572 (GRCm39) missense probably damaging 1.00
R1658:Ticrr UTSW 7 79,345,297 (GRCm39) missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79,328,794 (GRCm39) nonsense probably null
R1757:Ticrr UTSW 7 79,325,071 (GRCm39) missense probably damaging 0.99
R1862:Ticrr UTSW 7 79,344,955 (GRCm39) missense probably damaging 1.00
R1869:Ticrr UTSW 7 79,328,883 (GRCm39) missense probably damaging 1.00
R1938:Ticrr UTSW 7 79,325,142 (GRCm39) missense probably damaging 0.98
R1966:Ticrr UTSW 7 79,344,483 (GRCm39) nonsense probably null
R2006:Ticrr UTSW 7 79,343,821 (GRCm39) missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79,315,433 (GRCm39) missense probably benign 0.12
R3404:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3405:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3941:Ticrr UTSW 7 79,343,445 (GRCm39) intron probably benign
R3950:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3951:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3952:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R4967:Ticrr UTSW 7 79,310,158 (GRCm39) missense probably damaging 0.99
R4972:Ticrr UTSW 7 79,319,416 (GRCm39) missense probably damaging 0.98
R5259:Ticrr UTSW 7 79,344,471 (GRCm39) missense probably benign 0.01
R5272:Ticrr UTSW 7 79,319,353 (GRCm39) missense probably benign 0.44
R5374:Ticrr UTSW 7 79,340,690 (GRCm39) nonsense probably null
R5480:Ticrr UTSW 7 79,310,557 (GRCm39) missense probably damaging 1.00
R5568:Ticrr UTSW 7 79,345,044 (GRCm39) nonsense probably null
R5568:Ticrr UTSW 7 79,339,715 (GRCm39) critical splice donor site probably null
R5588:Ticrr UTSW 7 79,328,853 (GRCm39) missense probably damaging 1.00
R5698:Ticrr UTSW 7 79,328,881 (GRCm39) missense probably benign
R5879:Ticrr UTSW 7 79,346,438 (GRCm39) missense probably benign 0.12
R5980:Ticrr UTSW 7 79,310,703 (GRCm39) missense probably damaging 0.99
R6128:Ticrr UTSW 7 79,343,716 (GRCm39) missense probably damaging 1.00
R6277:Ticrr UTSW 7 79,344,444 (GRCm39) missense probably benign 0.00
R6335:Ticrr UTSW 7 79,344,031 (GRCm39) splice site probably null
R6866:Ticrr UTSW 7 79,343,705 (GRCm39) missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79,315,598 (GRCm39) missense probably benign 0.00
R6923:Ticrr UTSW 7 79,341,601 (GRCm39) missense probably damaging 0.98
R6962:Ticrr UTSW 7 79,315,645 (GRCm39) missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79,343,490 (GRCm39) missense probably damaging 0.96
R7285:Ticrr UTSW 7 79,310,610 (GRCm39) missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79,341,597 (GRCm39) missense possibly damaging 0.93
R7583:Ticrr UTSW 7 79,346,487 (GRCm39) nonsense probably null
R7749:Ticrr UTSW 7 79,328,844 (GRCm39) missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79,331,760 (GRCm39) missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79,319,233 (GRCm39) missense probably benign 0.23
R7935:Ticrr UTSW 7 79,331,584 (GRCm39) missense probably damaging 0.99
R8005:Ticrr UTSW 7 79,343,796 (GRCm39) missense probably damaging 0.98
R8080:Ticrr UTSW 7 79,334,012 (GRCm39) splice site probably null
R8181:Ticrr UTSW 7 79,310,728 (GRCm39) missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R8410:Ticrr UTSW 7 79,317,423 (GRCm39) missense probably damaging 0.98
R8449:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R9073:Ticrr UTSW 7 79,317,679 (GRCm39) missense probably benign 0.01
R9090:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9271:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9287:Ticrr UTSW 7 79,343,516 (GRCm39) missense possibly damaging 0.89
R9368:Ticrr UTSW 7 79,330,735 (GRCm39) missense probably damaging 0.99
R9469:Ticrr UTSW 7 79,344,511 (GRCm39) missense probably benign 0.03
R9502:Ticrr UTSW 7 79,343,597 (GRCm39) missense probably benign
R9614:Ticrr UTSW 7 79,345,754 (GRCm39) missense probably damaging 1.00
R9761:Ticrr UTSW 7 79,345,313 (GRCm39) missense probably damaging 1.00
R9779:Ticrr UTSW 7 79,328,802 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- CTACAGAAATGACATCAGCTGAAGG -3'
(R):5'- TTCTTGTGTCTGAGAGGCCC -3'

Sequencing Primer
(F):5'- TCAGCTGAAGGGACCATTTC -3'
(R):5'- TGCTTAGACGTGCCAGCAAG -3'
Posted On 2019-10-07