Incidental Mutation 'R7426:Prr14'
ID576082
Institutional Source Beutler Lab
Gene Symbol Prr14
Ensembl Gene ENSMUSG00000030822
Gene Nameproline rich 14
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R7426 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location127459611-127476759 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127475286 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 330 (I330T)
Ref Sequence ENSEMBL: ENSMUSP00000033095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033095] [ENSMUST00000106292] [ENSMUST00000133817] [ENSMUST00000133938] [ENSMUST00000205432] [ENSMUST00000206394] [ENSMUST00000206915]
Predicted Effect probably benign
Transcript: ENSMUST00000033095
AA Change: I330T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000033095
Gene: ENSMUSG00000030822
AA Change: I330T

DomainStartEndE-ValueType
low complexity region 241 256 N/A INTRINSIC
low complexity region 263 273 N/A INTRINSIC
low complexity region 297 309 N/A INTRINSIC
low complexity region 364 387 N/A INTRINSIC
Pfam:Tantalus 485 545 5.6e-28 PFAM
low complexity region 554 564 N/A INTRINSIC
low complexity region 587 603 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106292
AA Change: I330T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101899
Gene: ENSMUSG00000030822
AA Change: I330T

DomainStartEndE-ValueType
low complexity region 241 256 N/A INTRINSIC
low complexity region 263 273 N/A INTRINSIC
low complexity region 297 309 N/A INTRINSIC
low complexity region 364 387 N/A INTRINSIC
Pfam:Tantalus 487 544 1.7e-26 PFAM
low complexity region 554 564 N/A INTRINSIC
low complexity region 587 603 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132819
Predicted Effect probably benign
Transcript: ENSMUST00000133817
Predicted Effect probably benign
Transcript: ENSMUST00000133938
Predicted Effect probably benign
Transcript: ENSMUST00000205432
Predicted Effect probably benign
Transcript: ENSMUST00000206394
Predicted Effect probably benign
Transcript: ENSMUST00000206915
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (114/118)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene tethers heterochromatin to the nuclear laminar scaffold by binding heterochromatin protein 1 (HP1) and the nuclear lamina. The tether is broken during mitosis and reforms quickly after mitosis, with the encoded protein first binding HP1 and then attaching to the nuclear lamina. This protein also has been shown to promote MyoD activity and skeletal myogenesis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 C A 7: 120,345,998 N432K possibly damaging Het
Adamtsl5 G A 10: 80,344,859 T123I probably benign Het
Aff4 T C 11: 53,372,875 S241P probably damaging Het
Agl A G 3: 116,758,755 L510P Het
Aox2 A T 1: 58,289,983 K196* probably null Het
Arhgef37 A G 18: 61,504,385 L402P probably damaging Het
Arid4b T C 13: 14,181,306 probably null Het
Atp5f1 A G 3: 105,943,802 V193A probably benign Het
Atp8b3 A G 10: 80,529,629 probably null Het
Baz2a G T 10: 128,116,078 R555L probably damaging Het
Casp4 G T 9: 5,321,345 S32I possibly damaging Het
Cd300lb A G 11: 114,928,302 V167A probably damaging Het
Cdc42bpg C T 19: 6,318,398 T1042I probably damaging Het
Ceacam20 T C 7: 19,970,234 F70S probably damaging Het
Cep162 C T 9: 87,192,766 V1388I probably damaging Het
Cfap65 A G 1: 74,920,426 V855A possibly damaging Het
Chil3 G T 3: 106,155,706 D189E probably benign Het
Cln3 A G 7: 126,581,740 I43T probably benign Het
Cntnap5a A G 1: 116,442,380 Q909R probably benign Het
Ctsd C A 7: 142,383,541 A77S probably damaging Het
Dnah12 T A 14: 26,724,626 S781T probably benign Het
Dnah17 T A 11: 118,090,717 Q1716L probably null Het
Dock3 C A 9: 106,895,583 M490I probably benign Het
Erg T C 16: 95,459,156 probably null Het
Fam206a A G 4: 56,804,230 I82V probably null Het
Farp2 A T 1: 93,621,228 M1019L possibly damaging Het
Fcgbp A G 7: 28,086,524 K462R probably benign Het
Fn1 A T 1: 71,649,225 N173K probably damaging Het
Fsip2 A T 2: 82,980,097 L2253F probably damaging Het
Gabrd C T 4: 155,385,513 R413H possibly damaging Het
Galnt5 A T 2: 58,017,139 D538V probably damaging Het
Gje1 T A 10: 14,716,479 L186F probably damaging Het
Gm16686 A T 4: 88,755,326 C89S unknown Het
Gna15 G T 10: 81,502,997 A336E probably benign Het
Golga4 C T 9: 118,559,495 S1895L probably benign Het
Gon4l A T 3: 88,907,522 M1933L probably benign Het
Gpr183 T C 14: 121,954,744 S122G possibly damaging Het
Gtf2h4 G A 17: 35,669,358 T348I probably damaging Het
Hace1 T C 10: 45,605,540 Y120H probably damaging Het
Hivep2 C T 10: 14,131,317 H1220Y possibly damaging Het
Hmx2 T C 7: 131,554,503 F66S probably benign Het
Hoxd12 A T 2: 74,675,225 S47C possibly damaging Het
Hp C A 8: 109,575,200 probably null Het
Idh3a T A 9: 54,601,208 D355E probably benign Het
Itga2b A T 11: 102,456,294 M921K probably benign Het
Jcad A G 18: 4,675,529 D1097G probably benign Het
Kdm5b A T 1: 134,595,833 T249S probably benign Het
Klhl11 G T 11: 100,464,352 H214Q probably benign Het
L3hypdh A T 12: 72,084,931 Y76N probably damaging Het
Lama4 G T 10: 39,045,755 R424L possibly damaging Het
Lepr A G 4: 101,745,656 I214V probably benign Het
Lipc G T 9: 70,802,168 N432K probably benign Het
Lipm C T 19: 34,116,198 A216V possibly damaging Het
Lrrc23 A G 6: 124,779,125 S2P unknown Het
Lyst T A 13: 13,637,524 D840E probably benign Het
Mmp23 T A 4: 155,651,584 T204S probably damaging Het
Mms19 T C 19: 41,948,278 T785A probably benign Het
Mov10 A T 3: 104,800,052 probably null Het
Mtf2 A G 5: 108,100,970 T383A probably benign Het
Myo5c G A 9: 75,251,527 probably null Het
Nfxl1 A T 5: 72,524,174 C671* probably null Het
Npepps A G 11: 97,213,156 V813A probably benign Het
Nrn1 C A 13: 36,726,851 W69L probably damaging Het
Olfr231 A C 1: 174,117,187 F276L probably benign Het
Olfr543 A T 7: 102,477,676 Y65N probably damaging Het
Olfr656 C T 7: 104,617,852 H58Y probably damaging Het
Olfr663 T A 7: 104,703,589 D7E probably benign Het
Olfr694 T A 7: 106,689,210 I174F possibly damaging Het
Olfr771 A G 10: 129,160,751 Y78H possibly damaging Het
Olfr799 T C 10: 129,647,158 I10T probably damaging Het
Oprd1 A C 4: 132,114,067 D193E probably benign Het
Pcdhac1 G T 18: 37,092,497 V788L probably benign Het
Pcdhb11 G A 18: 37,423,260 V548M probably damaging Het
Pde4c A T 8: 70,748,972 E517V possibly damaging Het
Pdzd7 T C 19: 45,033,647 R521G possibly damaging Het
Pik3c2a T A 7: 116,372,854 K780N probably damaging Het
Plb1 T G 5: 32,321,247 probably null Het
Plcb4 T A 2: 136,000,219 L1041Q probably benign Het
Pnpla6 G A 8: 3,516,540 probably null Het
Ppat A T 5: 76,915,979 N441K probably damaging Het
Ppp1r1b G A 11: 98,355,479 A132T probably damaging Het
Prl2c2 A C 13: 12,997,480 probably null Het
Pycr1 T C 11: 120,642,923 D36G probably benign Het
Rabep2 T A 7: 126,438,719 I221N probably damaging Het
Rad23b A G 4: 55,370,469 D165G probably benign Het
Reln G A 5: 21,971,953 T1905I probably damaging Het
Ripor2 T C 13: 24,694,205 V321A probably benign Het
Rnf43 A G 11: 87,731,852 D466G probably benign Het
Rpl6 A T 5: 121,205,592 R63W possibly damaging Het
S100a14 A G 3: 90,528,204 T102A probably benign Het
Samd11 C A 4: 156,249,400 V195L probably benign Het
Scaper G A 9: 55,762,277 Q372* probably null Het
Sec14l5 G T 16: 5,180,875 C593F probably damaging Het
Sema6d T C 2: 124,654,158 Y41H probably damaging Het
Serac1 G A 17: 6,069,314 R114W probably damaging Het
Slc12a4 T C 8: 105,950,836 E388G probably benign Het
Smarcd3 T C 5: 24,595,812 T164A probably benign Het
Smtn C A 11: 3,530,249 R324L probably benign Het
Spata31d1c C T 13: 65,035,361 P239L probably benign Het
Srcap T C 7: 127,538,517 V1013A possibly damaging Het
Sv2b T C 7: 75,124,064 N553S probably damaging Het
Tex35 T A 1: 157,105,086 N52I probably damaging Het
Ticrr T C 7: 79,693,986 S1200P probably benign Het
Tmem19 A G 10: 115,347,699 L125P probably damaging Het
Trio A G 15: 27,856,107 V666A probably benign Het
Ttn T C 2: 76,917,283 D4474G probably benign Het
Usp43 A T 11: 67,893,016 S368T possibly damaging Het
Vmn2r72 T A 7: 85,751,140 M234L probably benign Het
Wdr93 T A 7: 79,777,307 probably null Het
Wrap73 T A 4: 154,156,127 W359R probably damaging Het
Ywhah A G 5: 33,026,641 I63V probably benign Het
Zbtb7b G T 3: 89,381,059 P151T probably damaging Het
Zfp318 A G 17: 46,400,069 N906S probably damaging Het
Zfp423 C A 8: 87,780,713 C1001F probably damaging Het
Zmym1 A G 4: 127,049,398 I399T possibly damaging Het
Zmynd15 G A 11: 70,462,188 G296D probably benign Het
Znfx1 T A 2: 167,048,555 I670F probably damaging Het
Other mutations in Prr14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Prr14 APN 7 127474647 missense probably benign 0.01
IGL01614:Prr14 APN 7 127475133 missense probably damaging 1.00
IGL01655:Prr14 APN 7 127475767 missense probably benign 0.00
IGL02273:Prr14 APN 7 127475936 missense probably damaging 1.00
IGL03033:Prr14 APN 7 127471963 missense probably damaging 1.00
R0364:Prr14 UTSW 7 127474579 missense probably benign 0.01
R0376:Prr14 UTSW 7 127476643 missense probably benign 0.33
R0448:Prr14 UTSW 7 127474726 unclassified probably benign
R0555:Prr14 UTSW 7 127472095 unclassified probably benign
R1462:Prr14 UTSW 7 127473988 critical splice donor site probably null
R1462:Prr14 UTSW 7 127473988 critical splice donor site probably null
R1534:Prr14 UTSW 7 127473982 missense probably benign 0.08
R1982:Prr14 UTSW 7 127475490 missense possibly damaging 0.87
R2357:Prr14 UTSW 7 127475363 missense probably benign 0.02
R4729:Prr14 UTSW 7 127474696 missense probably benign 0.00
R5582:Prr14 UTSW 7 127476397 missense probably damaging 1.00
R5757:Prr14 UTSW 7 127475553 missense possibly damaging 0.65
R6497:Prr14 UTSW 7 127474578 missense probably benign 0.03
R6987:Prr14 UTSW 7 127473805 missense possibly damaging 0.94
R7202:Prr14 UTSW 7 127476476 missense probably damaging 0.99
R7376:Prr14 UTSW 7 127476577 missense probably benign
R7380:Prr14 UTSW 7 127476442 missense probably null 1.00
R7470:Prr14 UTSW 7 127475825 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GATTCCAACATCGTCAAGCC -3'
(R):5'- CAACCCACAGTATGTCTCCG -3'

Sequencing Primer
(F):5'- AACATCGTCAAGCCTTTTACG -3'
(R):5'- AGTATGTCTCCGGGGCCTG -3'
Posted On2019-10-07