Incidental Mutation 'R0627:Lmod3'
ID 57609
Institutional Source Beutler Lab
Gene Symbol Lmod3
Ensembl Gene ENSMUSG00000044086
Gene Name leiomodin 3 (fetal)
Synonyms 5430424A14Rik
MMRRC Submission 038816-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R0627 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 97215495-97229720 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 97225032 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 263 (D263G)
Ref Sequence ENSEMBL: ENSMUSP00000093315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095655]
AlphaFold E9QA62
Predicted Effect probably damaging
Transcript: ENSMUST00000095655
AA Change: D263G

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093315
Gene: ENSMUSG00000044086
AA Change: D263G

DomainStartEndE-ValueType
Pfam:Tropomodulin 8 177 1.2e-13 PFAM
PDB:1IO0|A 248 406 9e-46 PDB
SCOP:d1a4ya_ 261 358 1e-3 SMART
low complexity region 407 427 N/A INTRINSIC
Meta Mutation Damage Score 0.4500 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.2%
Validation Efficiency 99% (111/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the leiomodin family of proteins. This protein contains three actin-binding domains, a tropomyosin domain, a leucine-rich repeat domain, and a Wiskott-Aldrich syndrome protein homology 2 domain (WH2). Localization of this protein to the pointed ends of thin filaments has been observed, and there is evidence that this protein acts as a catalyst of actin nucleation, and is important to the organization of sarcomeric thin filaments in skeletal muscles. Mutations in this gene have been associated as one cause of Nemaline myopathy, as other genes have also been linked to this disorder. Nemaline myopathy is a disorder characterized by nonprogressive generalized muscle weakness and protein inclusions (nemaline bodies) in skeletal myofibers. Patients with mutations in this gene often present with a severe congenital form of the disorder. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for an endonuclease-mediated mutation are runted and exhibit nemaline myopathy including a reduction in skeletal myofiber size, centrally nucleated skeletal muscle fibers, increase in skeletal muscle glycogen levels, and abnormal sarcomere and Z lines. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adm2 T A 15: 89,208,508 (GRCm39) Y149* probably null Het
Ahi1 G A 10: 20,841,421 (GRCm39) R236H probably benign Het
Armcx4 A G X: 133,596,572 (GRCm39) N2160S possibly damaging Het
Asns A T 6: 7,675,516 (GRCm39) D495E probably benign Het
Atosb G T 4: 43,036,242 (GRCm39) P163Q probably damaging Het
Bcl9 A G 3: 97,112,789 (GRCm39) V1222A probably damaging Het
Cd46 A T 1: 194,774,494 (GRCm39) C14S probably benign Het
Cdk11b T A 4: 155,725,229 (GRCm39) probably benign Het
Cdkl3 T C 11: 51,902,135 (GRCm39) Y115H probably damaging Het
Cep41 C A 6: 30,656,630 (GRCm39) C274F probably damaging Het
Ces1a C A 8: 93,768,671 (GRCm39) V108F probably benign Het
Clca4b A G 3: 144,634,020 (GRCm39) Y132H probably benign Het
Col5a3 T C 9: 20,686,781 (GRCm39) E1323G unknown Het
Cttnbp2 A G 6: 18,367,372 (GRCm39) *1139Q probably null Het
Cyp2d9 T A 15: 82,339,991 (GRCm39) I127N probably damaging Het
Dennd1b A G 1: 139,008,957 (GRCm39) Y220C probably damaging Het
Desi2 T C 1: 178,076,918 (GRCm39) S141P possibly damaging Het
Dgcr2 A G 16: 17,661,872 (GRCm39) S453P probably damaging Het
Dnah3 A G 7: 119,620,138 (GRCm39) L1586P probably damaging Het
Dpep3 T C 8: 106,705,363 (GRCm39) D129G possibly damaging Het
Eci3 C T 13: 35,132,126 (GRCm39) V241I possibly damaging Het
Ecm2 A T 13: 49,674,559 (GRCm39) probably benign Het
Emilin3 A G 2: 160,750,096 (GRCm39) L551P probably damaging Het
Erap1 A C 13: 74,823,933 (GRCm39) probably benign Het
Ern1 T C 11: 106,289,519 (GRCm39) D928G probably benign Het
Fancc C A 13: 63,465,292 (GRCm39) A472S probably damaging Het
Fkbp7 A T 2: 76,503,188 (GRCm39) D57E probably damaging Het
Gabbr2 T A 4: 46,681,223 (GRCm39) I703F possibly damaging Het
Gabrg3 A T 7: 56,374,343 (GRCm39) C408S probably damaging Het
Gm8674 T C 13: 50,053,751 (GRCm39) noncoding transcript Het
Gnas G A 2: 174,139,928 (GRCm39) probably benign Het
Grhl3 A G 4: 135,279,992 (GRCm39) V354A probably benign Het
Gsdme G T 6: 50,206,259 (GRCm39) probably benign Het
H2-D1 A G 17: 35,484,898 (GRCm39) E253G probably damaging Het
Habp2 A G 19: 56,302,478 (GRCm39) T31A probably damaging Het
Ifrd1 A G 12: 40,256,986 (GRCm39) probably null Het
Il20 A G 1: 130,837,476 (GRCm39) probably benign Het
Isx A T 8: 75,619,328 (GRCm39) I160F possibly damaging Het
Itgb2l T G 16: 96,224,111 (GRCm39) probably benign Het
Kcnv1 T G 15: 44,976,277 (GRCm39) probably benign Het
Kif17 T C 4: 138,015,798 (GRCm39) probably null Het
Kirrel3 A C 9: 34,946,470 (GRCm39) D743A probably damaging Het
Manf A G 9: 106,766,385 (GRCm39) L132P probably damaging Het
Mark2 C T 19: 7,259,325 (GRCm39) probably null Het
Med10 G A 13: 69,963,720 (GRCm39) S107N possibly damaging Het
Med31 A G 11: 72,104,601 (GRCm39) probably null Het
Mki67 C A 7: 135,309,987 (GRCm39) A155S probably benign Het
Mprip T A 11: 59,660,798 (GRCm39) L2193Q probably damaging Het
Mylk A G 16: 34,820,799 (GRCm39) N126S probably damaging Het
Myo16 A G 8: 10,489,689 (GRCm39) I715V probably benign Het
Myo18b T C 5: 112,946,700 (GRCm39) T1591A probably benign Het
Myt1 T A 2: 181,437,482 (GRCm39) D64E probably benign Het
Ndufa10 A T 1: 92,397,618 (GRCm39) Y61N probably damaging Het
Nob1 A G 8: 108,142,856 (GRCm39) F275S probably damaging Het
Nop2 T C 6: 125,116,667 (GRCm39) V333A possibly damaging Het
Ogdh T A 11: 6,297,216 (GRCm39) V545D possibly damaging Het
Or1l4b T G 2: 37,036,342 (GRCm39) N39K probably damaging Het
Or4p21 A G 2: 88,276,563 (GRCm39) S240P probably damaging Het
Or5b107 A G 19: 13,142,614 (GRCm39) T79A probably benign Het
Or5t16 T C 2: 86,819,358 (GRCm39) N54S probably benign Het
Or6d13 T A 6: 116,517,949 (GRCm39) N178K possibly damaging Het
Or6n2 G T 1: 173,897,643 (GRCm39) V260F probably damaging Het
Or9k2b A G 10: 130,016,557 (GRCm39) F64S probably damaging Het
Pcdhb1 T C 18: 37,398,774 (GRCm39) F242L probably damaging Het
Pkd2l2 A G 18: 34,558,155 (GRCm39) Y278C probably damaging Het
Plxdc1 T A 11: 97,823,030 (GRCm39) probably null Het
Ppp2r5b A G 19: 6,282,664 (GRCm39) probably benign Het
Pramel31 C A 4: 144,089,416 (GRCm39) L245I probably benign Het
Prelid2 T A 18: 42,070,717 (GRCm39) T39S possibly damaging Het
Prkd1 A T 12: 50,536,824 (GRCm39) F87I probably benign Het
Prl3d3 C T 13: 27,340,830 (GRCm39) T4I probably damaging Het
Proser3 T A 7: 30,240,208 (GRCm39) T299S probably benign Het
Ptprc G T 1: 137,996,058 (GRCm39) H1095N probably damaging Het
Rab11fip5 G T 6: 85,325,033 (GRCm39) P425T probably benign Het
Rac2 T C 15: 78,449,168 (GRCm39) T115A probably damaging Het
Rtl9 C A X: 141,884,271 (GRCm39) T561K possibly damaging Het
Runx2 T C 17: 44,969,392 (GRCm39) probably benign Het
Rxfp1 C T 3: 79,555,518 (GRCm39) V613I probably benign Het
Scn9a T C 2: 66,367,721 (GRCm39) K656R probably benign Het
Sec31b A G 19: 44,514,046 (GRCm39) S406P probably benign Het
Septin5 T C 16: 18,444,115 (GRCm39) D44G possibly damaging Het
Slc17a3 C T 13: 24,039,841 (GRCm39) S293F probably damaging Het
Slc35c2 T C 2: 165,124,056 (GRCm39) T94A possibly damaging Het
Slc8a3 T A 12: 81,361,616 (GRCm39) D401V probably damaging Het
Slitrk1 A T 14: 109,149,671 (GRCm39) C347S probably damaging Het
Smg1 G T 7: 117,767,084 (GRCm39) probably benign Het
Snx14 T C 9: 88,276,483 (GRCm39) K610E probably benign Het
Spata31e2 A G 1: 26,724,970 (GRCm39) M70T probably benign Het
Sppl2a A G 2: 126,762,337 (GRCm39) probably benign Het
Stk-ps2 T A 1: 46,068,851 (GRCm39) noncoding transcript Het
Sult3a1 T C 10: 33,740,010 (GRCm39) M23T probably benign Het
Syt5 A G 7: 4,548,682 (GRCm39) L50P possibly damaging Het
Tacr1 A G 6: 82,532,012 (GRCm39) I303V possibly damaging Het
Trip12 C A 1: 84,746,318 (GRCm39) V487F probably damaging Het
Vcp A G 4: 42,983,011 (GRCm39) S612P possibly damaging Het
Vmn1r47 A G 6: 89,999,788 (GRCm39) I307V probably null Het
Vmn1r83 T G 7: 12,055,919 (GRCm39) D46A probably damaging Het
Vmn2r118 G T 17: 55,917,772 (GRCm39) Q247K probably benign Het
Vmn2r94 C T 17: 18,477,427 (GRCm39) C328Y probably damaging Het
Vps13b T A 15: 35,372,145 (GRCm39) Y13* probably null Het
Vps13d C T 4: 144,813,754 (GRCm39) R3241H probably damaging Het
Wdr5b A G 16: 35,862,840 (GRCm39) T320A probably benign Het
Zfhx2 A T 14: 55,302,784 (GRCm39) D1733E probably benign Het
Zfp541 A G 7: 15,829,607 (GRCm39) probably benign Het
Zfp708 A T 13: 67,218,781 (GRCm39) Y314* probably null Het
Other mutations in Lmod3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Lmod3 APN 6 97,229,258 (GRCm39) missense probably damaging 0.99
IGL00465:Lmod3 APN 6 97,224,822 (GRCm39) missense probably damaging 1.00
IGL01401:Lmod3 APN 6 97,229,513 (GRCm39) missense probably damaging 1.00
IGL02279:Lmod3 APN 6 97,224,633 (GRCm39) missense probably damaging 1.00
IGL02621:Lmod3 APN 6 97,215,796 (GRCm39) utr 3 prime probably benign
IGL03116:Lmod3 APN 6 97,224,156 (GRCm39) missense possibly damaging 0.92
Runted UTSW 6 97,224,234 (GRCm39) missense probably damaging 1.00
R0086:Lmod3 UTSW 6 97,224,306 (GRCm39) missense probably damaging 1.00
R2208:Lmod3 UTSW 6 97,224,838 (GRCm39) missense probably benign 0.06
R4038:Lmod3 UTSW 6 97,225,275 (GRCm39) missense probably benign 0.06
R4913:Lmod3 UTSW 6 97,224,125 (GRCm39) splice site probably null
R5867:Lmod3 UTSW 6 97,224,963 (GRCm39) missense probably damaging 1.00
R5905:Lmod3 UTSW 6 97,224,575 (GRCm39) missense probably damaging 1.00
R6035:Lmod3 UTSW 6 97,224,234 (GRCm39) missense probably damaging 1.00
R6035:Lmod3 UTSW 6 97,224,234 (GRCm39) missense probably damaging 1.00
R6183:Lmod3 UTSW 6 97,229,514 (GRCm39) missense probably damaging 1.00
R6210:Lmod3 UTSW 6 97,224,262 (GRCm39) missense probably damaging 1.00
R6527:Lmod3 UTSW 6 97,224,339 (GRCm39) missense probably benign 0.00
R7225:Lmod3 UTSW 6 97,224,345 (GRCm39) missense probably benign 0.34
R7531:Lmod3 UTSW 6 97,225,403 (GRCm39) missense probably benign 0.01
R7908:Lmod3 UTSW 6 97,225,434 (GRCm39) missense probably benign 0.05
R8022:Lmod3 UTSW 6 97,225,260 (GRCm39) missense probably benign
R8154:Lmod3 UTSW 6 97,224,941 (GRCm39) missense probably damaging 1.00
R8325:Lmod3 UTSW 6 97,224,379 (GRCm39) missense probably benign 0.06
R9149:Lmod3 UTSW 6 97,224,625 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTTCCCAGTGATGAAGTTGGAC -3'
(R):5'- TGGCTACTAAAACAGCGCACGAG -3'

Sequencing Primer
(F):5'- AATATTGAGGGTGGTGACGC -3'
(R):5'- CAGCGCACGAGCAAAAAG -3'
Posted On 2013-07-11