Incidental Mutation 'R7426:Golga4'
ID 576095
Institutional Source Beutler Lab
Gene Symbol Golga4
Ensembl Gene ENSMUSG00000038708
Gene Name golgin A4
Synonyms golgin-245, Olp-1
MMRRC Submission 045504-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7426 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 118335335-118411587 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 118388563 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 1895 (S1895L)
Ref Sequence ENSEMBL: ENSMUSP00000081880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000212097]
AlphaFold Q91VW5
Predicted Effect probably benign
Transcript: ENSMUST00000084820
AA Change: S1895L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708
AA Change: S1895L

DomainStartEndE-ValueType
low complexity region 10 41 N/A INTRINSIC
coiled coil region 157 241 N/A INTRINSIC
internal_repeat_1 271 299 2.93e-5 PROSPERO
low complexity region 339 351 N/A INTRINSIC
low complexity region 513 532 N/A INTRINSIC
low complexity region 547 566 N/A INTRINSIC
low complexity region 705 715 N/A INTRINSIC
low complexity region 739 755 N/A INTRINSIC
low complexity region 882 895 N/A INTRINSIC
SCOP:d1epua_ 940 1076 2e-3 SMART
low complexity region 1138 1152 N/A INTRINSIC
low complexity region 1161 1182 N/A INTRINSIC
low complexity region 1204 1228 N/A INTRINSIC
coiled coil region 1283 1496 N/A INTRINSIC
internal_repeat_2 1500 1525 5.98e-5 PROSPERO
coiled coil region 1541 1715 N/A INTRINSIC
low complexity region 1756 1778 N/A INTRINSIC
internal_repeat_1 1811 1839 2.93e-5 PROSPERO
coiled coil region 1844 1883 N/A INTRINSIC
internal_repeat_2 1899 1924 5.98e-5 PROSPERO
coiled coil region 1933 2160 N/A INTRINSIC
Grip 2181 2225 1.38e-16 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000212097
Predicted Effect probably benign
Transcript: ENSMUST00000212183
Predicted Effect probably benign
Transcript: ENSMUST00000212274
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (114/118)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 C A 7: 119,945,221 (GRCm39) N432K possibly damaging Het
Abitram A G 4: 56,804,230 (GRCm39) I82V probably null Het
Adamtsl5 G A 10: 80,180,693 (GRCm39) T123I probably benign Het
Aff4 T C 11: 53,263,702 (GRCm39) S241P probably damaging Het
Agl A G 3: 116,552,404 (GRCm39) L510P Het
Aox1 A T 1: 58,329,142 (GRCm39) K196* probably null Het
Arhgef37 A G 18: 61,637,456 (GRCm39) L402P probably damaging Het
Arid4b T C 13: 14,355,891 (GRCm39) probably null Het
Atp5pb A G 3: 105,851,118 (GRCm39) V193A probably benign Het
Atp8b3 A G 10: 80,365,463 (GRCm39) probably null Het
Baz2a G T 10: 127,951,947 (GRCm39) R555L probably damaging Het
Casp4 G T 9: 5,321,345 (GRCm39) S32I possibly damaging Het
Cd300lb A G 11: 114,819,128 (GRCm39) V167A probably damaging Het
Cdc42bpg C T 19: 6,368,428 (GRCm39) T1042I probably damaging Het
Ceacam20 T C 7: 19,704,159 (GRCm39) F70S probably damaging Het
Cep162 C T 9: 87,074,819 (GRCm39) V1388I probably damaging Het
Cfap65 A G 1: 74,959,585 (GRCm39) V855A possibly damaging Het
Chil3 G T 3: 106,063,022 (GRCm39) D189E probably benign Het
Cln3 A G 7: 126,180,912 (GRCm39) I43T probably benign Het
Cntnap5a A G 1: 116,370,110 (GRCm39) Q909R probably benign Het
Ctsd C A 7: 141,937,278 (GRCm39) A77S probably damaging Het
Dnah12 T A 14: 26,445,781 (GRCm39) S781T probably benign Het
Dnah17 T A 11: 117,981,543 (GRCm39) Q1716L probably null Het
Dock3 C A 9: 106,772,782 (GRCm39) M490I probably benign Het
Erg T C 16: 95,260,015 (GRCm39) probably null Het
Farp2 A T 1: 93,548,950 (GRCm39) M1019L possibly damaging Het
Fcgbp A G 7: 27,785,949 (GRCm39) K462R probably benign Het
Fn1 A T 1: 71,688,384 (GRCm39) N173K probably damaging Het
Fsip2 A T 2: 82,810,441 (GRCm39) L2253F probably damaging Het
Gabrd C T 4: 155,469,970 (GRCm39) R413H possibly damaging Het
Galnt5 A T 2: 57,907,151 (GRCm39) D538V probably damaging Het
Gje1 T A 10: 14,592,223 (GRCm39) L186F probably damaging Het
Gm16686 A T 4: 88,673,563 (GRCm39) C89S unknown Het
Gna15 G T 10: 81,338,831 (GRCm39) A336E probably benign Het
Gon4l A T 3: 88,814,829 (GRCm39) M1933L probably benign Het
Gpr183 T C 14: 122,192,156 (GRCm39) S122G possibly damaging Het
Gtf2h4 G A 17: 35,980,250 (GRCm39) T348I probably damaging Het
Hace1 T C 10: 45,481,636 (GRCm39) Y120H probably damaging Het
Hivep2 C T 10: 14,007,061 (GRCm39) H1220Y possibly damaging Het
Hmx2 T C 7: 131,156,232 (GRCm39) F66S probably benign Het
Hoxd12 A T 2: 74,505,569 (GRCm39) S47C possibly damaging Het
Hp C A 8: 110,301,832 (GRCm39) probably null Het
Idh3a T A 9: 54,508,492 (GRCm39) D355E probably benign Het
Itga2b A T 11: 102,347,120 (GRCm39) M921K probably benign Het
Jcad A G 18: 4,675,529 (GRCm39) D1097G probably benign Het
Kdm5b A T 1: 134,523,571 (GRCm39) T249S probably benign Het
Klhl11 G T 11: 100,355,178 (GRCm39) H214Q probably benign Het
L3hypdh A T 12: 72,131,705 (GRCm39) Y76N probably damaging Het
Lama4 G T 10: 38,921,751 (GRCm39) R424L possibly damaging Het
Lepr A G 4: 101,602,853 (GRCm39) I214V probably benign Het
Lipc G T 9: 70,709,450 (GRCm39) N432K probably benign Het
Lipm C T 19: 34,093,598 (GRCm39) A216V possibly damaging Het
Lrrc23 A G 6: 124,756,088 (GRCm39) S2P unknown Het
Lyst T A 13: 13,812,109 (GRCm39) D840E probably benign Het
Mmp23 T A 4: 155,736,041 (GRCm39) T204S probably damaging Het
Mms19 T C 19: 41,936,717 (GRCm39) T785A probably benign Het
Mov10 A T 3: 104,707,368 (GRCm39) probably null Het
Mtf2 A G 5: 108,248,836 (GRCm39) T383A probably benign Het
Myo5c G A 9: 75,158,809 (GRCm39) probably null Het
Nfxl1 A T 5: 72,681,517 (GRCm39) C671* probably null Het
Npepps A G 11: 97,103,982 (GRCm39) V813A probably benign Het
Nrn1 C A 13: 36,910,825 (GRCm39) W69L probably damaging Het
Oprd1 A C 4: 131,841,378 (GRCm39) D193E probably benign Het
Or2ag1b T A 7: 106,288,417 (GRCm39) I174F possibly damaging Het
Or52p1 C T 7: 104,267,059 (GRCm39) H58Y probably damaging Het
Or55b3 A T 7: 102,126,883 (GRCm39) Y65N probably damaging Het
Or56b2j T A 7: 104,352,796 (GRCm39) D7E probably benign Het
Or6c202 A G 10: 128,996,620 (GRCm39) Y78H possibly damaging Het
Or6c209 T C 10: 129,483,027 (GRCm39) I10T probably damaging Het
Or6k6 A C 1: 173,944,753 (GRCm39) F276L probably benign Het
Pcdhac1 G T 18: 37,225,550 (GRCm39) V788L probably benign Het
Pcdhb11 G A 18: 37,556,313 (GRCm39) V548M probably damaging Het
Pde4c A T 8: 71,201,621 (GRCm39) E517V possibly damaging Het
Pdzd7 T C 19: 45,022,086 (GRCm39) R521G possibly damaging Het
Pik3c2a T A 7: 115,972,089 (GRCm39) K780N probably damaging Het
Plb1 T G 5: 32,478,591 (GRCm39) probably null Het
Plcb4 T A 2: 135,842,139 (GRCm39) L1041Q probably benign Het
Pnpla6 G A 8: 3,566,540 (GRCm39) probably null Het
Ppat A T 5: 77,063,826 (GRCm39) N441K probably damaging Het
Ppp1r1b G A 11: 98,246,305 (GRCm39) A132T probably damaging Het
Prl2c2 A C 13: 13,172,065 (GRCm39) probably null Het
Prr14 T C 7: 127,074,458 (GRCm39) I330T probably benign Het
Pycr1 T C 11: 120,533,749 (GRCm39) D36G probably benign Het
Rabep2 T A 7: 126,037,891 (GRCm39) I221N probably damaging Het
Rad23b A G 4: 55,370,469 (GRCm39) D165G probably benign Het
Reln G A 5: 22,176,951 (GRCm39) T1905I probably damaging Het
Ripor2 T C 13: 24,878,188 (GRCm39) V321A probably benign Het
Rnf43 A G 11: 87,622,678 (GRCm39) D466G probably benign Het
Rpl6 A T 5: 121,343,655 (GRCm39) R63W possibly damaging Het
S100a14 A G 3: 90,435,511 (GRCm39) T102A probably benign Het
Samd11 C A 4: 156,333,857 (GRCm39) V195L probably benign Het
Scaper G A 9: 55,669,561 (GRCm39) Q372* probably null Het
Sec14l5 G T 16: 4,998,739 (GRCm39) C593F probably damaging Het
Sema6d T C 2: 124,496,078 (GRCm39) Y41H probably damaging Het
Serac1 G A 17: 6,119,589 (GRCm39) R114W probably damaging Het
Slc12a4 T C 8: 106,677,468 (GRCm39) E388G probably benign Het
Smarcd3 T C 5: 24,800,810 (GRCm39) T164A probably benign Het
Smtn C A 11: 3,480,249 (GRCm39) R324L probably benign Het
Spata31d1c C T 13: 65,183,175 (GRCm39) P239L probably benign Het
Srcap T C 7: 127,137,689 (GRCm39) V1013A possibly damaging Het
Sv2b T C 7: 74,773,812 (GRCm39) N553S probably damaging Het
Tex35 T A 1: 156,932,656 (GRCm39) N52I probably damaging Het
Ticrr T C 7: 79,343,734 (GRCm39) S1200P probably benign Het
Tmem19 A G 10: 115,183,604 (GRCm39) L125P probably damaging Het
Trio A G 15: 27,856,193 (GRCm39) V666A probably benign Het
Ttn T C 2: 76,747,627 (GRCm39) D4474G probably benign Het
Usp43 A T 11: 67,783,842 (GRCm39) S368T possibly damaging Het
Vmn2r72 T A 7: 85,400,348 (GRCm39) M234L probably benign Het
Wdr93 T A 7: 79,427,055 (GRCm39) probably null Het
Wrap73 T A 4: 154,240,584 (GRCm39) W359R probably damaging Het
Ywhah A G 5: 33,183,985 (GRCm39) I63V probably benign Het
Zbtb7b G T 3: 89,288,366 (GRCm39) P151T probably damaging Het
Zfp318 A G 17: 46,710,995 (GRCm39) N906S probably damaging Het
Zfp423 C A 8: 88,507,341 (GRCm39) C1001F probably damaging Het
Zmym1 A G 4: 126,943,191 (GRCm39) I399T possibly damaging Het
Zmynd15 G A 11: 70,353,014 (GRCm39) G296D probably benign Het
Znfx1 T A 2: 166,890,475 (GRCm39) I670F probably damaging Het
Other mutations in Golga4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00711:Golga4 APN 9 118,343,339 (GRCm39) critical splice donor site probably null
IGL00801:Golga4 APN 9 118,367,994 (GRCm39) missense probably damaging 0.98
IGL01395:Golga4 APN 9 118,364,441 (GRCm39) missense probably damaging 1.00
IGL01472:Golga4 APN 9 118,361,642 (GRCm39) missense probably damaging 1.00
IGL01519:Golga4 APN 9 118,356,160 (GRCm39) missense probably damaging 1.00
IGL01563:Golga4 APN 9 118,356,074 (GRCm39) splice site probably benign
IGL02593:Golga4 APN 9 118,384,634 (GRCm39) unclassified probably benign
IGL02803:Golga4 APN 9 118,364,528 (GRCm39) missense probably benign
IGL02939:Golga4 APN 9 118,363,700 (GRCm39) missense probably damaging 1.00
IGL02939:Golga4 APN 9 118,364,522 (GRCm39) missense probably benign 0.01
IGL03123:Golga4 APN 9 118,365,953 (GRCm39) missense probably damaging 1.00
IGL03334:Golga4 APN 9 118,366,301 (GRCm39) splice site probably benign
F5770:Golga4 UTSW 9 118,385,143 (GRCm39) missense possibly damaging 0.62
F6893:Golga4 UTSW 9 118,382,525 (GRCm39) missense probably damaging 1.00
PIT4382001:Golga4 UTSW 9 118,382,521 (GRCm39) missense possibly damaging 0.88
R0179:Golga4 UTSW 9 118,389,808 (GRCm39) critical splice acceptor site probably null
R0279:Golga4 UTSW 9 118,398,061 (GRCm39) missense probably benign 0.00
R0362:Golga4 UTSW 9 118,384,853 (GRCm39) missense probably benign 0.13
R0973:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R0973:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R0974:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R1128:Golga4 UTSW 9 118,377,852 (GRCm39) missense probably benign 0.40
R1384:Golga4 UTSW 9 118,394,719 (GRCm39) missense probably damaging 0.99
R1435:Golga4 UTSW 9 118,364,508 (GRCm39) missense probably benign 0.00
R1513:Golga4 UTSW 9 118,384,800 (GRCm39) missense probably benign 0.02
R1818:Golga4 UTSW 9 118,402,055 (GRCm39) missense probably damaging 1.00
R2083:Golga4 UTSW 9 118,361,658 (GRCm39) missense probably damaging 1.00
R2243:Golga4 UTSW 9 118,385,972 (GRCm39) missense probably benign 0.06
R2355:Golga4 UTSW 9 118,389,810 (GRCm39) missense probably benign 0.00
R2518:Golga4 UTSW 9 118,385,680 (GRCm39) missense probably damaging 1.00
R2921:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R2922:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R2923:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R3121:Golga4 UTSW 9 118,386,448 (GRCm39) missense possibly damaging 0.68
R3424:Golga4 UTSW 9 118,363,715 (GRCm39) missense probably benign 0.16
R3909:Golga4 UTSW 9 118,387,804 (GRCm39) missense possibly damaging 0.82
R3913:Golga4 UTSW 9 118,368,039 (GRCm39) missense probably damaging 0.99
R4321:Golga4 UTSW 9 118,385,503 (GRCm39) missense probably damaging 1.00
R4358:Golga4 UTSW 9 118,380,946 (GRCm39) missense probably benign 0.16
R4483:Golga4 UTSW 9 118,343,254 (GRCm39) missense probably damaging 1.00
R4515:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4518:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4519:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4545:Golga4 UTSW 9 118,385,913 (GRCm39) missense probably damaging 1.00
R4546:Golga4 UTSW 9 118,385,913 (GRCm39) missense probably damaging 1.00
R4580:Golga4 UTSW 9 118,386,327 (GRCm39) missense probably benign 0.00
R4918:Golga4 UTSW 9 118,387,213 (GRCm39) missense probably damaging 1.00
R5007:Golga4 UTSW 9 118,387,368 (GRCm39) missense probably benign
R5045:Golga4 UTSW 9 118,394,724 (GRCm39) missense probably benign
R5232:Golga4 UTSW 9 118,335,626 (GRCm39) critical splice donor site probably null
R5256:Golga4 UTSW 9 118,385,569 (GRCm39) missense possibly damaging 0.93
R5502:Golga4 UTSW 9 118,388,125 (GRCm39) nonsense probably null
R5567:Golga4 UTSW 9 118,387,251 (GRCm39) missense probably damaging 1.00
R5576:Golga4 UTSW 9 118,382,602 (GRCm39) missense probably benign 0.13
R5771:Golga4 UTSW 9 118,387,351 (GRCm39) missense probably damaging 0.96
R5807:Golga4 UTSW 9 118,356,198 (GRCm39) missense probably damaging 0.99
R5860:Golga4 UTSW 9 118,387,174 (GRCm39) missense probably damaging 1.00
R6012:Golga4 UTSW 9 118,388,764 (GRCm39) missense possibly damaging 0.90
R6285:Golga4 UTSW 9 118,387,695 (GRCm39) nonsense probably null
R6299:Golga4 UTSW 9 118,386,438 (GRCm39) missense probably benign 0.03
R6467:Golga4 UTSW 9 118,365,860 (GRCm39) missense probably damaging 1.00
R6552:Golga4 UTSW 9 118,343,299 (GRCm39) missense probably damaging 1.00
R6688:Golga4 UTSW 9 118,343,278 (GRCm39) missense possibly damaging 0.66
R6965:Golga4 UTSW 9 118,377,847 (GRCm39) missense probably damaging 1.00
R6987:Golga4 UTSW 9 118,387,600 (GRCm39) missense probably benign
R7212:Golga4 UTSW 9 118,365,908 (GRCm39) missense possibly damaging 0.80
R7431:Golga4 UTSW 9 118,388,799 (GRCm39) missense probably damaging 1.00
R7641:Golga4 UTSW 9 118,386,643 (GRCm39) missense probably benign 0.05
R7727:Golga4 UTSW 9 118,377,770 (GRCm39) missense probably damaging 1.00
R7729:Golga4 UTSW 9 118,385,131 (GRCm39) missense possibly damaging 0.51
R7811:Golga4 UTSW 9 118,361,643 (GRCm39) missense probably damaging 1.00
R7849:Golga4 UTSW 9 118,388,379 (GRCm39) missense possibly damaging 0.93
R7891:Golga4 UTSW 9 118,385,434 (GRCm39) missense probably damaging 1.00
R7976:Golga4 UTSW 9 118,365,836 (GRCm39) missense possibly damaging 0.49
R8275:Golga4 UTSW 9 118,361,627 (GRCm39) missense probably damaging 1.00
R8378:Golga4 UTSW 9 118,387,390 (GRCm39) missense probably benign 0.03
R8514:Golga4 UTSW 9 118,384,864 (GRCm39) missense possibly damaging 0.47
R8698:Golga4 UTSW 9 118,385,029 (GRCm39) missense probably damaging 0.97
R8856:Golga4 UTSW 9 118,385,779 (GRCm39) missense probably damaging 0.98
R9227:Golga4 UTSW 9 118,385,941 (GRCm39) missense possibly damaging 0.94
R9282:Golga4 UTSW 9 118,385,893 (GRCm39) missense probably damaging 1.00
RF022:Golga4 UTSW 9 118,387,057 (GRCm39) missense probably damaging 1.00
V7583:Golga4 UTSW 9 118,385,143 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AATTGTGTCTCAGCCCATGGG -3'
(R):5'- TTCAGGATGTCCAGCTCCTG -3'

Sequencing Primer
(F):5'- TCTCAGCCCATGGGAGAAG -3'
(R):5'- AGCTCCTTCTGCAGCCTCG -3'
Posted On 2019-10-07