Incidental Mutation 'R7426:Atp8b3'
ID 576101
Institutional Source Beutler Lab
Gene Symbol Atp8b3
Ensembl Gene ENSMUSG00000003341
Gene Name ATPase, class I, type 8B, member 3
Synonyms 1700042F02Rik, 1700056N23Rik, SAPLT
MMRRC Submission 045504-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R7426 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 80355418-80374958 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 80365463 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000020383] [ENSMUST00000220326]
AlphaFold Q6UQ17
Predicted Effect probably null
Transcript: ENSMUST00000020383
SMART Domains Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 20 97 9.3e-29 PFAM
Pfam:E1-E2_ATPase 121 367 2.2e-10 PFAM
Pfam:HAD 404 866 3.7e-17 PFAM
Pfam:Cation_ATPase 481 580 8.3e-12 PFAM
Pfam:PhoLip_ATPase_C 883 1135 4.2e-61 PFAM
low complexity region 1140 1153 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000020383
SMART Domains Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 20 97 9.3e-29 PFAM
Pfam:E1-E2_ATPase 121 367 2.2e-10 PFAM
Pfam:HAD 404 866 3.7e-17 PFAM
Pfam:Cation_ATPase 481 580 8.3e-12 PFAM
Pfam:PhoLip_ATPase_C 883 1135 4.2e-61 PFAM
low complexity region 1140 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220326
Meta Mutation Damage Score 0.9685 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (114/118)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 C A 7: 119,945,221 (GRCm39) N432K possibly damaging Het
Abitram A G 4: 56,804,230 (GRCm39) I82V probably null Het
Adamtsl5 G A 10: 80,180,693 (GRCm39) T123I probably benign Het
Aff4 T C 11: 53,263,702 (GRCm39) S241P probably damaging Het
Agl A G 3: 116,552,404 (GRCm39) L510P Het
Aox1 A T 1: 58,329,142 (GRCm39) K196* probably null Het
Arhgef37 A G 18: 61,637,456 (GRCm39) L402P probably damaging Het
Arid4b T C 13: 14,355,891 (GRCm39) probably null Het
Atp5pb A G 3: 105,851,118 (GRCm39) V193A probably benign Het
Baz2a G T 10: 127,951,947 (GRCm39) R555L probably damaging Het
Casp4 G T 9: 5,321,345 (GRCm39) S32I possibly damaging Het
Cd300lb A G 11: 114,819,128 (GRCm39) V167A probably damaging Het
Cdc42bpg C T 19: 6,368,428 (GRCm39) T1042I probably damaging Het
Ceacam20 T C 7: 19,704,159 (GRCm39) F70S probably damaging Het
Cep162 C T 9: 87,074,819 (GRCm39) V1388I probably damaging Het
Cfap65 A G 1: 74,959,585 (GRCm39) V855A possibly damaging Het
Chil3 G T 3: 106,063,022 (GRCm39) D189E probably benign Het
Cln3 A G 7: 126,180,912 (GRCm39) I43T probably benign Het
Cntnap5a A G 1: 116,370,110 (GRCm39) Q909R probably benign Het
Ctsd C A 7: 141,937,278 (GRCm39) A77S probably damaging Het
Dnah12 T A 14: 26,445,781 (GRCm39) S781T probably benign Het
Dnah17 T A 11: 117,981,543 (GRCm39) Q1716L probably null Het
Dock3 C A 9: 106,772,782 (GRCm39) M490I probably benign Het
Erg T C 16: 95,260,015 (GRCm39) probably null Het
Farp2 A T 1: 93,548,950 (GRCm39) M1019L possibly damaging Het
Fcgbp A G 7: 27,785,949 (GRCm39) K462R probably benign Het
Fn1 A T 1: 71,688,384 (GRCm39) N173K probably damaging Het
Fsip2 A T 2: 82,810,441 (GRCm39) L2253F probably damaging Het
Gabrd C T 4: 155,469,970 (GRCm39) R413H possibly damaging Het
Galnt5 A T 2: 57,907,151 (GRCm39) D538V probably damaging Het
Gje1 T A 10: 14,592,223 (GRCm39) L186F probably damaging Het
Gm16686 A T 4: 88,673,563 (GRCm39) C89S unknown Het
Gna15 G T 10: 81,338,831 (GRCm39) A336E probably benign Het
Golga4 C T 9: 118,388,563 (GRCm39) S1895L probably benign Het
Gon4l A T 3: 88,814,829 (GRCm39) M1933L probably benign Het
Gpr183 T C 14: 122,192,156 (GRCm39) S122G possibly damaging Het
Gtf2h4 G A 17: 35,980,250 (GRCm39) T348I probably damaging Het
Hace1 T C 10: 45,481,636 (GRCm39) Y120H probably damaging Het
Hivep2 C T 10: 14,007,061 (GRCm39) H1220Y possibly damaging Het
Hmx2 T C 7: 131,156,232 (GRCm39) F66S probably benign Het
Hoxd12 A T 2: 74,505,569 (GRCm39) S47C possibly damaging Het
Hp C A 8: 110,301,832 (GRCm39) probably null Het
Idh3a T A 9: 54,508,492 (GRCm39) D355E probably benign Het
Itga2b A T 11: 102,347,120 (GRCm39) M921K probably benign Het
Jcad A G 18: 4,675,529 (GRCm39) D1097G probably benign Het
Kdm5b A T 1: 134,523,571 (GRCm39) T249S probably benign Het
Klhl11 G T 11: 100,355,178 (GRCm39) H214Q probably benign Het
L3hypdh A T 12: 72,131,705 (GRCm39) Y76N probably damaging Het
Lama4 G T 10: 38,921,751 (GRCm39) R424L possibly damaging Het
Lepr A G 4: 101,602,853 (GRCm39) I214V probably benign Het
Lipc G T 9: 70,709,450 (GRCm39) N432K probably benign Het
Lipm C T 19: 34,093,598 (GRCm39) A216V possibly damaging Het
Lrrc23 A G 6: 124,756,088 (GRCm39) S2P unknown Het
Lyst T A 13: 13,812,109 (GRCm39) D840E probably benign Het
Mmp23 T A 4: 155,736,041 (GRCm39) T204S probably damaging Het
Mms19 T C 19: 41,936,717 (GRCm39) T785A probably benign Het
Mov10 A T 3: 104,707,368 (GRCm39) probably null Het
Mtf2 A G 5: 108,248,836 (GRCm39) T383A probably benign Het
Myo5c G A 9: 75,158,809 (GRCm39) probably null Het
Nfxl1 A T 5: 72,681,517 (GRCm39) C671* probably null Het
Npepps A G 11: 97,103,982 (GRCm39) V813A probably benign Het
Nrn1 C A 13: 36,910,825 (GRCm39) W69L probably damaging Het
Oprd1 A C 4: 131,841,378 (GRCm39) D193E probably benign Het
Or2ag1b T A 7: 106,288,417 (GRCm39) I174F possibly damaging Het
Or52p1 C T 7: 104,267,059 (GRCm39) H58Y probably damaging Het
Or55b3 A T 7: 102,126,883 (GRCm39) Y65N probably damaging Het
Or56b2j T A 7: 104,352,796 (GRCm39) D7E probably benign Het
Or6c202 A G 10: 128,996,620 (GRCm39) Y78H possibly damaging Het
Or6c209 T C 10: 129,483,027 (GRCm39) I10T probably damaging Het
Or6k6 A C 1: 173,944,753 (GRCm39) F276L probably benign Het
Pcdhac1 G T 18: 37,225,550 (GRCm39) V788L probably benign Het
Pcdhb11 G A 18: 37,556,313 (GRCm39) V548M probably damaging Het
Pde4c A T 8: 71,201,621 (GRCm39) E517V possibly damaging Het
Pdzd7 T C 19: 45,022,086 (GRCm39) R521G possibly damaging Het
Pik3c2a T A 7: 115,972,089 (GRCm39) K780N probably damaging Het
Plb1 T G 5: 32,478,591 (GRCm39) probably null Het
Plcb4 T A 2: 135,842,139 (GRCm39) L1041Q probably benign Het
Pnpla6 G A 8: 3,566,540 (GRCm39) probably null Het
Ppat A T 5: 77,063,826 (GRCm39) N441K probably damaging Het
Ppp1r1b G A 11: 98,246,305 (GRCm39) A132T probably damaging Het
Prl2c2 A C 13: 13,172,065 (GRCm39) probably null Het
Prr14 T C 7: 127,074,458 (GRCm39) I330T probably benign Het
Pycr1 T C 11: 120,533,749 (GRCm39) D36G probably benign Het
Rabep2 T A 7: 126,037,891 (GRCm39) I221N probably damaging Het
Rad23b A G 4: 55,370,469 (GRCm39) D165G probably benign Het
Reln G A 5: 22,176,951 (GRCm39) T1905I probably damaging Het
Ripor2 T C 13: 24,878,188 (GRCm39) V321A probably benign Het
Rnf43 A G 11: 87,622,678 (GRCm39) D466G probably benign Het
Rpl6 A T 5: 121,343,655 (GRCm39) R63W possibly damaging Het
S100a14 A G 3: 90,435,511 (GRCm39) T102A probably benign Het
Samd11 C A 4: 156,333,857 (GRCm39) V195L probably benign Het
Scaper G A 9: 55,669,561 (GRCm39) Q372* probably null Het
Sec14l5 G T 16: 4,998,739 (GRCm39) C593F probably damaging Het
Sema6d T C 2: 124,496,078 (GRCm39) Y41H probably damaging Het
Serac1 G A 17: 6,119,589 (GRCm39) R114W probably damaging Het
Slc12a4 T C 8: 106,677,468 (GRCm39) E388G probably benign Het
Smarcd3 T C 5: 24,800,810 (GRCm39) T164A probably benign Het
Smtn C A 11: 3,480,249 (GRCm39) R324L probably benign Het
Spata31d1c C T 13: 65,183,175 (GRCm39) P239L probably benign Het
Srcap T C 7: 127,137,689 (GRCm39) V1013A possibly damaging Het
Sv2b T C 7: 74,773,812 (GRCm39) N553S probably damaging Het
Tex35 T A 1: 156,932,656 (GRCm39) N52I probably damaging Het
Ticrr T C 7: 79,343,734 (GRCm39) S1200P probably benign Het
Tmem19 A G 10: 115,183,604 (GRCm39) L125P probably damaging Het
Trio A G 15: 27,856,193 (GRCm39) V666A probably benign Het
Ttn T C 2: 76,747,627 (GRCm39) D4474G probably benign Het
Usp43 A T 11: 67,783,842 (GRCm39) S368T possibly damaging Het
Vmn2r72 T A 7: 85,400,348 (GRCm39) M234L probably benign Het
Wdr93 T A 7: 79,427,055 (GRCm39) probably null Het
Wrap73 T A 4: 154,240,584 (GRCm39) W359R probably damaging Het
Ywhah A G 5: 33,183,985 (GRCm39) I63V probably benign Het
Zbtb7b G T 3: 89,288,366 (GRCm39) P151T probably damaging Het
Zfp318 A G 17: 46,710,995 (GRCm39) N906S probably damaging Het
Zfp423 C A 8: 88,507,341 (GRCm39) C1001F probably damaging Het
Zmym1 A G 4: 126,943,191 (GRCm39) I399T possibly damaging Het
Zmynd15 G A 11: 70,353,014 (GRCm39) G296D probably benign Het
Znfx1 T A 2: 166,890,475 (GRCm39) I670F probably damaging Het
Other mutations in Atp8b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Atp8b3 APN 10 80,366,821 (GRCm39) missense probably damaging 1.00
IGL00484:Atp8b3 APN 10 80,361,998 (GRCm39) splice site probably benign
IGL00904:Atp8b3 APN 10 80,364,598 (GRCm39) missense probably damaging 1.00
IGL01326:Atp8b3 APN 10 80,360,210 (GRCm39) missense probably damaging 0.98
IGL01368:Atp8b3 APN 10 80,370,063 (GRCm39) splice site probably benign
IGL01448:Atp8b3 APN 10 80,356,256 (GRCm39) missense probably benign 0.02
IGL01556:Atp8b3 APN 10 80,366,802 (GRCm39) nonsense probably null
IGL01754:Atp8b3 APN 10 80,366,795 (GRCm39) splice site probably null
IGL01809:Atp8b3 APN 10 80,355,845 (GRCm39) missense probably benign 0.02
IGL01895:Atp8b3 APN 10 80,357,662 (GRCm39) missense possibly damaging 0.80
IGL02184:Atp8b3 APN 10 80,363,067 (GRCm39) splice site probably benign
IGL02224:Atp8b3 APN 10 80,361,810 (GRCm39) splice site probably benign
IGL02377:Atp8b3 APN 10 80,356,128 (GRCm39) missense probably benign 0.06
IGL02405:Atp8b3 APN 10 80,366,462 (GRCm39) missense probably damaging 1.00
IGL03090:Atp8b3 APN 10 80,366,438 (GRCm39) missense probably damaging 1.00
IGL03244:Atp8b3 APN 10 80,370,292 (GRCm39) missense probably damaging 1.00
PIT4544001:Atp8b3 UTSW 10 80,366,420 (GRCm39) missense probably benign 0.14
R0277:Atp8b3 UTSW 10 80,362,743 (GRCm39) missense probably benign 0.21
R0908:Atp8b3 UTSW 10 80,355,918 (GRCm39) missense probably benign 0.03
R0973:Atp8b3 UTSW 10 80,370,032 (GRCm39) missense probably damaging 1.00
R1069:Atp8b3 UTSW 10 80,366,852 (GRCm39) missense probably damaging 1.00
R1087:Atp8b3 UTSW 10 80,356,017 (GRCm39) missense probably benign 0.00
R1553:Atp8b3 UTSW 10 80,368,376 (GRCm39) missense probably damaging 1.00
R1603:Atp8b3 UTSW 10 80,361,619 (GRCm39) missense probably benign 0.06
R1606:Atp8b3 UTSW 10 80,368,412 (GRCm39) missense probably damaging 1.00
R1707:Atp8b3 UTSW 10 80,357,635 (GRCm39) splice site probably null
R1717:Atp8b3 UTSW 10 80,364,631 (GRCm39) missense probably damaging 1.00
R1876:Atp8b3 UTSW 10 80,365,912 (GRCm39) missense possibly damaging 0.70
R1939:Atp8b3 UTSW 10 80,361,220 (GRCm39) nonsense probably null
R2138:Atp8b3 UTSW 10 80,362,939 (GRCm39) missense possibly damaging 0.79
R2239:Atp8b3 UTSW 10 80,366,822 (GRCm39) missense probably damaging 1.00
R2429:Atp8b3 UTSW 10 80,362,728 (GRCm39) missense probably benign 0.02
R2696:Atp8b3 UTSW 10 80,370,017 (GRCm39) missense possibly damaging 0.94
R2910:Atp8b3 UTSW 10 80,355,746 (GRCm39) missense possibly damaging 0.90
R3424:Atp8b3 UTSW 10 80,372,181 (GRCm39) missense probably benign 0.35
R3425:Atp8b3 UTSW 10 80,372,181 (GRCm39) missense probably benign 0.35
R3432:Atp8b3 UTSW 10 80,362,014 (GRCm39) missense probably benign 0.10
R3841:Atp8b3 UTSW 10 80,365,540 (GRCm39) missense possibly damaging 0.95
R4515:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4518:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4519:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4619:Atp8b3 UTSW 10 80,361,858 (GRCm39) missense possibly damaging 0.67
R4648:Atp8b3 UTSW 10 80,361,457 (GRCm39) missense possibly damaging 0.94
R4709:Atp8b3 UTSW 10 80,372,604 (GRCm39) splice site probably null
R4774:Atp8b3 UTSW 10 80,372,156 (GRCm39) missense probably damaging 1.00
R4796:Atp8b3 UTSW 10 80,360,188 (GRCm39) missense probably damaging 1.00
R5000:Atp8b3 UTSW 10 80,357,676 (GRCm39) missense possibly damaging 0.82
R5398:Atp8b3 UTSW 10 80,365,533 (GRCm39) missense probably damaging 1.00
R5778:Atp8b3 UTSW 10 80,356,007 (GRCm39) missense probably benign
R5990:Atp8b3 UTSW 10 80,361,531 (GRCm39) missense possibly damaging 0.65
R6124:Atp8b3 UTSW 10 80,365,515 (GRCm39) missense probably damaging 1.00
R6427:Atp8b3 UTSW 10 80,356,157 (GRCm39) splice site probably null
R6748:Atp8b3 UTSW 10 80,361,058 (GRCm39) missense possibly damaging 0.56
R6756:Atp8b3 UTSW 10 80,361,895 (GRCm39) missense possibly damaging 0.76
R7051:Atp8b3 UTSW 10 80,365,552 (GRCm39) missense probably damaging 0.99
R7051:Atp8b3 UTSW 10 80,355,858 (GRCm39) missense probably benign 0.02
R7052:Atp8b3 UTSW 10 80,355,858 (GRCm39) missense probably benign 0.02
R7418:Atp8b3 UTSW 10 80,365,926 (GRCm39) missense probably damaging 0.99
R7625:Atp8b3 UTSW 10 80,355,980 (GRCm39) missense probably benign 0.00
R7673:Atp8b3 UTSW 10 80,360,240 (GRCm39) missense probably damaging 0.99
R7921:Atp8b3 UTSW 10 80,366,437 (GRCm39) missense probably damaging 1.00
R8077:Atp8b3 UTSW 10 80,366,858 (GRCm39) missense possibly damaging 0.95
R8235:Atp8b3 UTSW 10 80,365,650 (GRCm39) missense probably damaging 0.96
R8354:Atp8b3 UTSW 10 80,361,633 (GRCm39) missense probably benign 0.00
R8454:Atp8b3 UTSW 10 80,361,633 (GRCm39) missense probably benign 0.00
R8501:Atp8b3 UTSW 10 80,355,980 (GRCm39) missense probably benign
R8712:Atp8b3 UTSW 10 80,365,923 (GRCm39) missense possibly damaging 0.52
R8962:Atp8b3 UTSW 10 80,355,896 (GRCm39) missense probably benign 0.13
R9129:Atp8b3 UTSW 10 80,368,412 (GRCm39) missense probably damaging 1.00
R9333:Atp8b3 UTSW 10 80,360,180 (GRCm39) missense probably benign 0.01
R9438:Atp8b3 UTSW 10 80,361,409 (GRCm39) missense probably damaging 1.00
R9486:Atp8b3 UTSW 10 80,366,821 (GRCm39) missense probably damaging 1.00
R9554:Atp8b3 UTSW 10 80,360,197 (GRCm39) missense probably damaging 1.00
R9570:Atp8b3 UTSW 10 80,361,822 (GRCm39) missense probably benign 0.05
R9682:Atp8b3 UTSW 10 80,371,230 (GRCm39) missense probably damaging 1.00
R9748:Atp8b3 UTSW 10 80,364,407 (GRCm39) missense probably damaging 0.96
RF006:Atp8b3 UTSW 10 80,362,070 (GRCm39) missense probably benign 0.15
Z1177:Atp8b3 UTSW 10 80,366,911 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGCGTCCCATGTTCATCGTC -3'
(R):5'- CTGGGACCTCAATATGTACTACG -3'

Sequencing Primer
(F):5'- ATCTGGGGAAAGAACTCTGCTTC -3'
(R):5'- TATGTACTACGAGCCACTGGACATG -3'
Posted On 2019-10-07