Incidental Mutation 'R7426:Lyst'
ID 576120
Institutional Source Beutler Lab
Gene Symbol Lyst
Ensembl Gene ENSMUSG00000019726
Gene Name lysosomal trafficking regulator
Synonyms D13Sfk13
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_010748.2; MGI:107448

Essential gene? Possibly non essential (E-score: 0.318) question?
Stock # R7426 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 13590397-13778803 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 13637524 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 840 (D840E)
Ref Sequence ENSEMBL: ENSMUSP00000106188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110559]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000110559
AA Change: D840E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106188
Gene: ENSMUSG00000019726
AA Change: D840E

DomainStartEndE-ValueType
low complexity region 26 36 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 2295 2307 N/A INTRINSIC
low complexity region 2427 2445 N/A INTRINSIC
low complexity region 2534 2546 N/A INTRINSIC
Pfam:PH_BEACH 3006 3101 5.8e-25 PFAM
Beach 3118 3408 1.25e-193 SMART
Blast:Beach 3441 3478 9e-13 BLAST
WD40 3539 3579 5.75e-1 SMART
WD40 3591 3630 2.89e-5 SMART
WD40 3633 3676 1.38e0 SMART
WD40 3724 3765 1.27e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (114/118)
MGI Phenotype Strain: 1855968
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that regulates intracellular protein trafficking in endosomes, and may be involved in pigmentation. Mutations in this gene are associated with Chediak-Higashi syndrome, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants, though the full-length nature of some of these variants has not been determined. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous mice have a phenotype similar to human Chediak-Higashi syndrome patients, exhibiting lysosomal dysfunction with resultant protein storage; diluted coat color; abnormal melanogenesis; immune cell dysfunction resulting in increased susceptibility to bacterial, viral, and parasitic infections and decreased cytotoxic activity against tumor cells. [provided by MGI curators]
Allele List at MGI

All alleles(52) : Targeted(3) Gene trapped(34) Spontaneous(8) Chemically induced(6) Radiation induced(1)

Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 C A 7: 120,345,998 N432K possibly damaging Het
Adamtsl5 G A 10: 80,344,859 T123I probably benign Het
Aff4 T C 11: 53,372,875 S241P probably damaging Het
Agl A G 3: 116,758,755 L510P Het
Aox2 A T 1: 58,289,983 K196* probably null Het
Arhgef37 A G 18: 61,504,385 L402P probably damaging Het
Arid4b T C 13: 14,181,306 probably null Het
Atp5f1 A G 3: 105,943,802 V193A probably benign Het
Atp8b3 A G 10: 80,529,629 probably null Het
Baz2a G T 10: 128,116,078 R555L probably damaging Het
Casp4 G T 9: 5,321,345 S32I possibly damaging Het
Cd300lb A G 11: 114,928,302 V167A probably damaging Het
Cdc42bpg C T 19: 6,318,398 T1042I probably damaging Het
Ceacam20 T C 7: 19,970,234 F70S probably damaging Het
Cep162 C T 9: 87,192,766 V1388I probably damaging Het
Cfap65 A G 1: 74,920,426 V855A possibly damaging Het
Chil3 G T 3: 106,155,706 D189E probably benign Het
Cln3 A G 7: 126,581,740 I43T probably benign Het
Cntnap5a A G 1: 116,442,380 Q909R probably benign Het
Ctsd C A 7: 142,383,541 A77S probably damaging Het
Dnah12 T A 14: 26,724,626 S781T probably benign Het
Dnah17 T A 11: 118,090,717 Q1716L probably null Het
Dock3 C A 9: 106,895,583 M490I probably benign Het
Erg T C 16: 95,459,156 probably null Het
Fam206a A G 4: 56,804,230 I82V probably null Het
Farp2 A T 1: 93,621,228 M1019L possibly damaging Het
Fcgbp A G 7: 28,086,524 K462R probably benign Het
Fn1 A T 1: 71,649,225 N173K probably damaging Het
Fsip2 A T 2: 82,980,097 L2253F probably damaging Het
Gabrd C T 4: 155,385,513 R413H possibly damaging Het
Galnt5 A T 2: 58,017,139 D538V probably damaging Het
Gje1 T A 10: 14,716,479 L186F probably damaging Het
Gm16686 A T 4: 88,755,326 C89S unknown Het
Gna15 G T 10: 81,502,997 A336E probably benign Het
Golga4 C T 9: 118,559,495 S1895L probably benign Het
Gon4l A T 3: 88,907,522 M1933L probably benign Het
Gpr183 T C 14: 121,954,744 S122G possibly damaging Het
Gtf2h4 G A 17: 35,669,358 T348I probably damaging Het
Hace1 T C 10: 45,605,540 Y120H probably damaging Het
Hivep2 C T 10: 14,131,317 H1220Y possibly damaging Het
Hmx2 T C 7: 131,554,503 F66S probably benign Het
Hoxd12 A T 2: 74,675,225 S47C possibly damaging Het
Hp C A 8: 109,575,200 probably null Het
Idh3a T A 9: 54,601,208 D355E probably benign Het
Itga2b A T 11: 102,456,294 M921K probably benign Het
Jcad A G 18: 4,675,529 D1097G probably benign Het
Kdm5b A T 1: 134,595,833 T249S probably benign Het
Klhl11 G T 11: 100,464,352 H214Q probably benign Het
L3hypdh A T 12: 72,084,931 Y76N probably damaging Het
Lama4 G T 10: 39,045,755 R424L possibly damaging Het
Lepr A G 4: 101,745,656 I214V probably benign Het
Lipc G T 9: 70,802,168 N432K probably benign Het
Lipm C T 19: 34,116,198 A216V possibly damaging Het
Lrrc23 A G 6: 124,779,125 S2P unknown Het
Mmp23 T A 4: 155,651,584 T204S probably damaging Het
Mms19 T C 19: 41,948,278 T785A probably benign Het
Mov10 A T 3: 104,800,052 probably null Het
Mtf2 A G 5: 108,100,970 T383A probably benign Het
Myo5c G A 9: 75,251,527 probably null Het
Nfxl1 A T 5: 72,524,174 C671* probably null Het
Npepps A G 11: 97,213,156 V813A probably benign Het
Nrn1 C A 13: 36,726,851 W69L probably damaging Het
Olfr231 A C 1: 174,117,187 F276L probably benign Het
Olfr543 A T 7: 102,477,676 Y65N probably damaging Het
Olfr656 C T 7: 104,617,852 H58Y probably damaging Het
Olfr663 T A 7: 104,703,589 D7E probably benign Het
Olfr694 T A 7: 106,689,210 I174F possibly damaging Het
Olfr771 A G 10: 129,160,751 Y78H possibly damaging Het
Olfr799 T C 10: 129,647,158 I10T probably damaging Het
Oprd1 A C 4: 132,114,067 D193E probably benign Het
Pcdhac1 G T 18: 37,092,497 V788L probably benign Het
Pcdhb11 G A 18: 37,423,260 V548M probably damaging Het
Pde4c A T 8: 70,748,972 E517V possibly damaging Het
Pdzd7 T C 19: 45,033,647 R521G possibly damaging Het
Pik3c2a T A 7: 116,372,854 K780N probably damaging Het
Plb1 T G 5: 32,321,247 probably null Het
Plcb4 T A 2: 136,000,219 L1041Q probably benign Het
Pnpla6 G A 8: 3,516,540 probably null Het
Ppat A T 5: 76,915,979 N441K probably damaging Het
Ppp1r1b G A 11: 98,355,479 A132T probably damaging Het
Prl2c2 A C 13: 12,997,480 probably null Het
Prr14 T C 7: 127,475,286 I330T probably benign Het
Pycr1 T C 11: 120,642,923 D36G probably benign Het
Rabep2 T A 7: 126,438,719 I221N probably damaging Het
Rad23b A G 4: 55,370,469 D165G probably benign Het
Reln G A 5: 21,971,953 T1905I probably damaging Het
Ripor2 T C 13: 24,694,205 V321A probably benign Het
Rnf43 A G 11: 87,731,852 D466G probably benign Het
Rpl6 A T 5: 121,205,592 R63W possibly damaging Het
S100a14 A G 3: 90,528,204 T102A probably benign Het
Samd11 C A 4: 156,249,400 V195L probably benign Het
Scaper G A 9: 55,762,277 Q372* probably null Het
Sec14l5 G T 16: 5,180,875 C593F probably damaging Het
Sema6d T C 2: 124,654,158 Y41H probably damaging Het
Serac1 G A 17: 6,069,314 R114W probably damaging Het
Slc12a4 T C 8: 105,950,836 E388G probably benign Het
Smarcd3 T C 5: 24,595,812 T164A probably benign Het
Smtn C A 11: 3,530,249 R324L probably benign Het
Spata31d1c C T 13: 65,035,361 P239L probably benign Het
Srcap T C 7: 127,538,517 V1013A possibly damaging Het
Sv2b T C 7: 75,124,064 N553S probably damaging Het
Tex35 T A 1: 157,105,086 N52I probably damaging Het
Ticrr T C 7: 79,693,986 S1200P probably benign Het
Tmem19 A G 10: 115,347,699 L125P probably damaging Het
Trio A G 15: 27,856,107 V666A probably benign Het
Ttn T C 2: 76,917,283 D4474G probably benign Het
Usp43 A T 11: 67,893,016 S368T possibly damaging Het
Vmn2r72 T A 7: 85,751,140 M234L probably benign Het
Wdr93 T A 7: 79,777,307 probably null Het
Wrap73 T A 4: 154,156,127 W359R probably damaging Het
Ywhah A G 5: 33,026,641 I63V probably benign Het
Zbtb7b G T 3: 89,381,059 P151T probably damaging Het
Zfp318 A G 17: 46,400,069 N906S probably damaging Het
Zfp423 C A 8: 87,780,713 C1001F probably damaging Het
Zmym1 A G 4: 127,049,398 I399T possibly damaging Het
Zmynd15 G A 11: 70,462,188 G296D probably benign Het
Znfx1 T A 2: 167,048,555 I670F probably damaging Het
Other mutations in Lyst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Lyst APN 13 13648878 missense probably benign
IGL00474:Lyst APN 13 13643536 missense possibly damaging 0.48
IGL00484:Lyst APN 13 13709603 missense probably benign 0.02
IGL00492:Lyst APN 13 13678175 missense possibly damaging 0.54
IGL00807:Lyst APN 13 13650423 missense possibly damaging 0.91
IGL00949:Lyst APN 13 13635485 missense possibly damaging 0.87
IGL00952:Lyst APN 13 13678107 missense probably benign 0.05
IGL01305:Lyst APN 13 13678056 missense probably benign 0.01
IGL01317:Lyst APN 13 13670870 missense probably benign
IGL01419:Lyst APN 13 13635838 missense probably benign 0.00
IGL01445:Lyst APN 13 13651714 missense probably benign 0.00
IGL01690:Lyst APN 13 13743246 missense probably damaging 1.00
IGL01791:Lyst APN 13 13635302 missense probably damaging 1.00
IGL01809:Lyst APN 13 13637803 missense probably damaging 1.00
IGL01896:Lyst APN 13 13635577 missense probably benign 0.04
IGL01938:Lyst APN 13 13637424 missense possibly damaging 0.93
IGL01986:Lyst APN 13 13775627 critical splice donor site probably null
IGL02022:Lyst APN 13 13664044 nonsense probably null
IGL02044:Lyst APN 13 13712846 missense probably damaging 1.00
IGL02157:Lyst APN 13 13660956 missense probably benign
IGL02185:Lyst APN 13 13661093 nonsense probably null
IGL02215:Lyst APN 13 13660956 missense probably benign
IGL02245:Lyst APN 13 13660956 missense probably benign
IGL02246:Lyst APN 13 13660956 missense probably benign
IGL02247:Lyst APN 13 13660956 missense probably benign
IGL02297:Lyst APN 13 13638092 nonsense probably null
IGL02411:Lyst APN 13 13660956 missense probably benign
IGL02415:Lyst APN 13 13660956 missense probably benign
IGL02419:Lyst APN 13 13660956 missense probably benign
IGL02420:Lyst APN 13 13660956 missense probably benign
IGL02429:Lyst APN 13 13660956 missense probably benign
IGL02501:Lyst APN 13 13711645 missense probably benign 0.02
IGL02522:Lyst APN 13 13634705 missense possibly damaging 0.81
IGL02535:Lyst APN 13 13650342 missense probably benign 0.00
IGL02596:Lyst APN 13 13660956 missense probably benign
IGL02601:Lyst APN 13 13660956 missense probably benign
IGL02603:Lyst APN 13 13660956 missense probably benign
IGL02608:Lyst APN 13 13712754 missense probably damaging 0.98
IGL02622:Lyst APN 13 13681390 missense probably damaging 1.00
IGL02690:Lyst APN 13 13641125 missense possibly damaging 0.58
IGL02715:Lyst APN 13 13674320 splice site probably null
IGL02725:Lyst APN 13 13760827 missense probably damaging 1.00
IGL02729:Lyst APN 13 13674339 missense possibly damaging 0.81
IGL02729:Lyst APN 13 13746609 missense possibly damaging 0.95
IGL02820:Lyst APN 13 13638058 missense probably benign 0.03
IGL02945:Lyst APN 13 13761198 missense possibly damaging 0.48
IGL02981:Lyst APN 13 13634911 missense probably damaging 0.99
IGL03087:Lyst APN 13 13635056 missense probably damaging 1.00
IGL03149:Lyst APN 13 13681444 missense probably benign 0.14
IGL03158:Lyst APN 13 13651752 critical splice donor site probably null
IGL03226:Lyst APN 13 13709559 missense probably benign 0.01
IGL03242:Lyst APN 13 13656881 nonsense probably null
IGL03385:Lyst APN 13 13656980 nonsense probably null
50-cal UTSW 13 13708212 critical splice donor site probably null
charcoal UTSW 13 13696761 nonsense probably null
charlotte_gray UTSW 13 13602026 intron probably benign
charzard UTSW 13 13647083 nonsense probably null
grey_wolf UTSW 13 unclassified
lightspeed UTSW 13 13740536 missense possibly damaging 0.91
pardon UTSW 13 13677952 missense probably benign 0.00
robin UTSW 13 13648802 nonsense probably null
sooty UTSW 13 unclassified
souris UTSW 13 13683224 unclassified probably benign
Swallow UTSW 13 13757422 missense probably benign 0.00
vulpix UTSW 13 13696794 splice site probably null
ANU22:Lyst UTSW 13 13678056 missense probably benign 0.01
IGL02835:Lyst UTSW 13 13661100 missense possibly damaging 0.82
P0031:Lyst UTSW 13 13664031 missense probably damaging 1.00
R0012:Lyst UTSW 13 13687694 missense probably benign 0.10
R0012:Lyst UTSW 13 13687694 missense probably benign 0.10
R0031:Lyst UTSW 13 13708156 missense probably benign 0.14
R0115:Lyst UTSW 13 13677952 missense probably benign 0.00
R0212:Lyst UTSW 13 13635985 missense possibly damaging 0.93
R0386:Lyst UTSW 13 13708214 splice site probably benign
R0393:Lyst UTSW 13 13647079 missense probably benign 0.01
R0415:Lyst UTSW 13 13711610 splice site probably benign
R0446:Lyst UTSW 13 13638048 missense probably benign 0.00
R0481:Lyst UTSW 13 13677952 missense probably benign 0.00
R0499:Lyst UTSW 13 13616713 missense probably damaging 1.00
R0506:Lyst UTSW 13 13638015 missense probably benign
R0530:Lyst UTSW 13 13757306 splice site probably benign
R0541:Lyst UTSW 13 13681293 missense probably benign 0.00
R0570:Lyst UTSW 13 13709386 missense probably benign 0.26
R0680:Lyst UTSW 13 13650341 missense probably benign 0.01
R0842:Lyst UTSW 13 13678241 nonsense probably null
R0848:Lyst UTSW 13 13634930 missense probably benign 0.00
R1014:Lyst UTSW 13 13634060 missense possibly damaging 0.49
R1205:Lyst UTSW 13 13680202 missense probably benign
R1251:Lyst UTSW 13 13634483 missense probably benign 0.00
R1304:Lyst UTSW 13 13751984 nonsense probably null
R1398:Lyst UTSW 13 13740536 missense possibly damaging 0.91
R1445:Lyst UTSW 13 13640054 missense possibly damaging 0.94
R1475:Lyst UTSW 13 13708212 critical splice donor site probably null
R1479:Lyst UTSW 13 13634482 missense probably benign 0.00
R1484:Lyst UTSW 13 13678190 missense probably benign 0.01
R1498:Lyst UTSW 13 13650375 missense possibly damaging 0.49
R1540:Lyst UTSW 13 13635101 missense possibly damaging 0.81
R1611:Lyst UTSW 13 13634897 missense probably damaging 0.97
R1653:Lyst UTSW 13 13635226 missense probably damaging 1.00
R1669:Lyst UTSW 13 13644087 missense possibly damaging 0.90
R1686:Lyst UTSW 13 13634705 missense possibly damaging 0.81
R1694:Lyst UTSW 13 13661161 missense probably damaging 0.98
R1747:Lyst UTSW 13 13757422 missense probably benign 0.00
R1793:Lyst UTSW 13 13647083 nonsense probably null
R1871:Lyst UTSW 13 13651712 missense probably benign 0.00
R1905:Lyst UTSW 13 13634134 missense probably benign
R1958:Lyst UTSW 13 13616618 missense probably damaging 1.00
R1969:Lyst UTSW 13 13730344 missense probably damaging 0.99
R2040:Lyst UTSW 13 13641222 missense probably benign 0.00
R2109:Lyst UTSW 13 13712820 missense possibly damaging 0.46
R2116:Lyst UTSW 13 13635701 missense probably damaging 0.99
R2121:Lyst UTSW 13 13660971 missense probably damaging 1.00
R2127:Lyst UTSW 13 13635262 missense probably damaging 1.00
R2187:Lyst UTSW 13 13709341 missense possibly damaging 0.61
R2238:Lyst UTSW 13 13743263 missense probably benign 0.41
R2258:Lyst UTSW 13 13637658 missense probably benign 0.00
R2292:Lyst UTSW 13 13740495 missense probably damaging 1.00
R2368:Lyst UTSW 13 13696663 missense probably damaging 0.96
R2908:Lyst UTSW 13 13669873 missense probably benign 0.03
R3001:Lyst UTSW 13 13696705 missense probably benign
R3002:Lyst UTSW 13 13696705 missense probably benign
R3024:Lyst UTSW 13 13658687 missense probably benign
R3113:Lyst UTSW 13 13669927 missense probably benign 0.12
R3406:Lyst UTSW 13 13635230 missense possibly damaging 0.56
R3972:Lyst UTSW 13 13706625 missense possibly damaging 0.67
R3978:Lyst UTSW 13 13634168 missense possibly damaging 0.82
R4032:Lyst UTSW 13 13616665 missense probably damaging 1.00
R4192:Lyst UTSW 13 13740513 missense probably damaging 1.00
R4206:Lyst UTSW 13 13635989 missense probably benign 0.03
R4298:Lyst UTSW 13 13634887 missense probably damaging 1.00
R4344:Lyst UTSW 13 13698466 missense probably benign 0.06
R4441:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4445:Lyst UTSW 13 13709564 missense probably benign 0.42
R4477:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4493:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4494:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4495:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4622:Lyst UTSW 13 13674398 missense probably benign 0.01
R4638:Lyst UTSW 13 13696794 splice site probably null
R4658:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4675:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4719:Lyst UTSW 13 13650350 missense probably benign
R4729:Lyst UTSW 13 13637901 missense probably damaging 1.00
R4774:Lyst UTSW 13 13740597 missense probably damaging 1.00
R4811:Lyst UTSW 13 13777100 missense probably benign 0.33
R4877:Lyst UTSW 13 13683149 missense probably damaging 1.00
R4920:Lyst UTSW 13 13647060 missense possibly damaging 0.79
R4933:Lyst UTSW 13 13637764 missense probably damaging 0.98
R4933:Lyst UTSW 13 13759378 missense probably benign 0.12
R4958:Lyst UTSW 13 13635463 missense probably benign 0.00
R4982:Lyst UTSW 13 13725954 missense probably damaging 1.00
R4992:Lyst UTSW 13 13661163 missense probably damaging 1.00
R5024:Lyst UTSW 13 13634404 missense probably benign
R5049:Lyst UTSW 13 13636064 missense probably damaging 1.00
R5079:Lyst UTSW 13 13757353 missense probably benign 0.08
R5254:Lyst UTSW 13 13683070 missense probably benign 0.00
R5266:Lyst UTSW 13 13660970 missense probably damaging 1.00
R5279:Lyst UTSW 13 13648802 nonsense probably null
R5285:Lyst UTSW 13 13634426 missense probably benign 0.01
R5364:Lyst UTSW 13 13656854 missense probably benign 0.35
R5435:Lyst UTSW 13 13777064 missense possibly damaging 0.64
R5516:Lyst UTSW 13 13644122 missense probably benign 0.10
R5524:Lyst UTSW 13 13746779 missense probably benign 0.03
R5591:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5592:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5593:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5594:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5594:Lyst UTSW 13 13759397 missense probably benign 0.00
R5644:Lyst UTSW 13 13637496 missense possibly damaging 0.58
R5659:Lyst UTSW 13 13634627 missense possibly damaging 0.58
R5741:Lyst UTSW 13 13634030 missense probably benign 0.44
R5908:Lyst UTSW 13 13696761 nonsense probably null
R5969:Lyst UTSW 13 13687813 splice site probably null
R6128:Lyst UTSW 13 13759379 missense possibly damaging 0.67
R6271:Lyst UTSW 13 13658754 missense probably benign 0.30
R6315:Lyst UTSW 13 13643504 missense probably benign
R6318:Lyst UTSW 13 13743311 missense possibly damaging 0.88
R6555:Lyst UTSW 13 13648925 missense probably benign 0.01
R6663:Lyst UTSW 13 13664116 splice site probably null
R6701:Lyst UTSW 13 13681485 missense probably benign 0.06
R6711:Lyst UTSW 13 13635235 missense possibly damaging 0.80
R6909:Lyst UTSW 13 13743375 missense probably damaging 1.00
R6915:Lyst UTSW 13 13726044 missense probably benign 0.01
R6929:Lyst UTSW 13 13743324 missense probably damaging 1.00
R6960:Lyst UTSW 13 13634078 missense probably benign 0.12
R7018:Lyst UTSW 13 13743459 critical splice donor site probably null
R7037:Lyst UTSW 13 13616666 missense probably damaging 1.00
R7045:Lyst UTSW 13 13634900 missense probably benign 0.34
R7045:Lyst UTSW 13 13637708 missense probably damaging 1.00
R7070:Lyst UTSW 13 13757444 missense probably benign 0.23
R7188:Lyst UTSW 13 13752090 missense possibly damaging 0.66
R7201:Lyst UTSW 13 13709300 nonsense probably null
R7210:Lyst UTSW 13 13656983 missense probably damaging 1.00
R7229:Lyst UTSW 13 13643509 missense probably benign 0.00
R7293:Lyst UTSW 13 13680237 missense probably benign 0.01
R7318:Lyst UTSW 13 13757443 missense probably benign 0.13
R7344:Lyst UTSW 13 13706555 missense probably benign
R7522:Lyst UTSW 13 13647083 nonsense probably null
R7583:Lyst UTSW 13 13635887 missense probably damaging 1.00
R7606:Lyst UTSW 13 13637475 missense probably damaging 1.00
R7636:Lyst UTSW 13 13616747 critical splice donor site probably null
R7658:Lyst UTSW 13 13730476 missense possibly damaging 0.63
R7685:Lyst UTSW 13 13669865 missense probably benign 0.00
R7689:Lyst UTSW 13 13683223 critical splice donor site probably null
R7765:Lyst UTSW 13 13709532 missense possibly damaging 0.75
R7779:Lyst UTSW 13 13634543 missense probably damaging 1.00
R7871:Lyst UTSW 13 13636052 nonsense probably null
R7872:Lyst UTSW 13 13635865 missense probably benign 0.14
R7884:Lyst UTSW 13 13707683 missense probably benign 0.09
R7890:Lyst UTSW 13 13740569 missense probably damaging 0.99
R7916:Lyst UTSW 13 13647072 missense possibly damaging 0.64
R7948:Lyst UTSW 13 13746589 missense possibly damaging 0.59
R7956:Lyst UTSW 13 13641203 missense possibly damaging 0.80
R8048:Lyst UTSW 13 13687645 missense probably benign 0.12
R8085:Lyst UTSW 13 13634309 missense probably damaging 0.98
R8165:Lyst UTSW 13 13698360 missense probably damaging 0.99
R8235:Lyst UTSW 13 13760738 missense possibly damaging 0.69
R8237:Lyst UTSW 13 13651732 missense probably benign 0.00
R8275:Lyst UTSW 13 13776082 missense probably benign 0.02
R8300:Lyst UTSW 13 13664058 missense possibly damaging 0.79
R8350:Lyst UTSW 13 13650388 nonsense probably null
R8526:Lyst UTSW 13 13760806 missense probably damaging 0.99
R8551:Lyst UTSW 13 13634060 missense possibly damaging 0.77
R8723:Lyst UTSW 13 13712757 missense possibly damaging 0.89
R8772:Lyst UTSW 13 13637492 nonsense probably null
R8778:Lyst UTSW 13 13635776 missense possibly damaging 0.89
R8778:Lyst UTSW 13 13728567 missense possibly damaging 0.89
R8801:Lyst UTSW 13 13661010 missense probably benign 0.10
R8837:Lyst UTSW 13 13677963 missense probably benign
R8874:Lyst UTSW 13 13637562 missense probably benign
R8878:Lyst UTSW 13 13641076 missense probably benign 0.00
R8891:Lyst UTSW 13 13712850 missense possibly damaging 0.67
R9077:Lyst UTSW 13 13683108 missense probably benign 0.02
R9127:Lyst UTSW 13 13634242 missense probably damaging 1.00
R9143:Lyst UTSW 13 13661165 missense probably damaging 0.98
R9216:Lyst UTSW 13 13648603 missense probably benign
R9217:Lyst UTSW 13 13696660 missense probably benign 0.01
R9291:Lyst UTSW 13 13709353 missense probably benign 0.01
R9302:Lyst UTSW 13 13730362 missense possibly damaging 0.46
R9370:Lyst UTSW 13 13760748 missense probably damaging 1.00
R9402:Lyst UTSW 13 13637878 missense probably benign
R9457:Lyst UTSW 13 13687745 missense possibly damaging 0.83
R9481:Lyst UTSW 13 13683068 missense possibly damaging 0.68
R9563:Lyst UTSW 13 13637823 missense probably benign 0.36
R9623:Lyst UTSW 13 13678002 missense probably benign
R9661:Lyst UTSW 13 13634194 missense probably benign 0.01
R9682:Lyst UTSW 13 13656941 missense probably benign 0.21
R9743:Lyst UTSW 13 13634738 missense possibly damaging 0.67
R9801:Lyst UTSW 13 13634705 missense probably damaging 0.97
RF001:Lyst UTSW 13 13635841 missense probably benign
RF002:Lyst UTSW 13 13634363 missense probably benign 0.05
X0024:Lyst UTSW 13 13634448 missense probably benign 0.00
X0026:Lyst UTSW 13 13751970 missense probably damaging 0.99
Z1088:Lyst UTSW 13 13743433 missense probably benign 0.09
Z1176:Lyst UTSW 13 13640107 missense probably damaging 1.00
Z1176:Lyst UTSW 13 13777079 missense probably benign 0.27
Z1177:Lyst UTSW 13 13680134 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TTTTCCTCTCTCACAGGGTAATAAG -3'
(R):5'- ATTGGCAGACTCCCTATCAGAG -3'

Sequencing Primer
(F):5'- TCTCTCACAGGGTAATAAGAGATTTG -3'
(R):5'- GAGTCTGCTTCTTTACTGACACATAG -3'
Posted On 2019-10-07