Incidental Mutation 'R7426:Cdc42bpg'
ID576136
Institutional Source Beutler Lab
Gene Symbol Cdc42bpg
Ensembl Gene ENSMUSG00000024769
Gene NameCDC42 binding protein kinase gamma (DMPK-like)
SynonymsMRCKgamma
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock #R7426 (G1)
Quality Score151.008
Status Validated
Chromosome19
Chromosomal Location6306456-6325652 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 6318398 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1042 (T1042I)
Ref Sequence ENSEMBL: ENSMUSP00000025681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025681]
Predicted Effect probably damaging
Transcript: ENSMUST00000025681
AA Change: T1042I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025681
Gene: ENSMUSG00000024769
AA Change: T1042I

DomainStartEndE-ValueType
low complexity region 21 31 N/A INTRINSIC
S_TKc 71 337 1.63e-87 SMART
S_TK_X 338 400 7.85e-12 SMART
coiled coil region 444 551 N/A INTRINSIC
coiled coil region 630 675 N/A INTRINSIC
Pfam:DMPK_coil 743 801 4.6e-21 PFAM
low complexity region 861 873 N/A INTRINSIC
C1 878 926 1.78e-7 SMART
PH 947 1067 3.57e-10 SMART
Pfam:CNH 1096 1362 7.5e-56 PFAM
low complexity region 1401 1412 N/A INTRINSIC
low complexity region 1535 1551 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (114/118)
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 C A 7: 120,345,998 N432K possibly damaging Het
Adamtsl5 G A 10: 80,344,859 T123I probably benign Het
Aff4 T C 11: 53,372,875 S241P probably damaging Het
Agl A G 3: 116,758,755 L510P Het
Aox2 A T 1: 58,289,983 K196* probably null Het
Arhgef37 A G 18: 61,504,385 L402P probably damaging Het
Arid4b T C 13: 14,181,306 probably null Het
Atp5f1 A G 3: 105,943,802 V193A probably benign Het
Atp8b3 A G 10: 80,529,629 probably null Het
Baz2a G T 10: 128,116,078 R555L probably damaging Het
Casp4 G T 9: 5,321,345 S32I possibly damaging Het
Cd300lb A G 11: 114,928,302 V167A probably damaging Het
Ceacam20 T C 7: 19,970,234 F70S probably damaging Het
Cep162 C T 9: 87,192,766 V1388I probably damaging Het
Cfap65 A G 1: 74,920,426 V855A possibly damaging Het
Chil3 G T 3: 106,155,706 D189E probably benign Het
Cln3 A G 7: 126,581,740 I43T probably benign Het
Cntnap5a A G 1: 116,442,380 Q909R probably benign Het
Ctsd C A 7: 142,383,541 A77S probably damaging Het
Dnah12 T A 14: 26,724,626 S781T probably benign Het
Dnah17 T A 11: 118,090,717 Q1716L probably null Het
Dock3 C A 9: 106,895,583 M490I probably benign Het
Erg T C 16: 95,459,156 probably null Het
Fam206a A G 4: 56,804,230 I82V probably null Het
Farp2 A T 1: 93,621,228 M1019L possibly damaging Het
Fcgbp A G 7: 28,086,524 K462R probably benign Het
Fn1 A T 1: 71,649,225 N173K probably damaging Het
Fsip2 A T 2: 82,980,097 L2253F probably damaging Het
Gabrd C T 4: 155,385,513 R413H possibly damaging Het
Galnt5 A T 2: 58,017,139 D538V probably damaging Het
Gje1 T A 10: 14,716,479 L186F probably damaging Het
Gm16686 A T 4: 88,755,326 C89S unknown Het
Gna15 G T 10: 81,502,997 A336E probably benign Het
Golga4 C T 9: 118,559,495 S1895L probably benign Het
Gon4l A T 3: 88,907,522 M1933L probably benign Het
Gpr183 T C 14: 121,954,744 S122G possibly damaging Het
Gtf2h4 G A 17: 35,669,358 T348I probably damaging Het
Hace1 T C 10: 45,605,540 Y120H probably damaging Het
Hivep2 C T 10: 14,131,317 H1220Y possibly damaging Het
Hmx2 T C 7: 131,554,503 F66S probably benign Het
Hoxd12 A T 2: 74,675,225 S47C possibly damaging Het
Hp C A 8: 109,575,200 probably null Het
Idh3a T A 9: 54,601,208 D355E probably benign Het
Itga2b A T 11: 102,456,294 M921K probably benign Het
Jcad A G 18: 4,675,529 D1097G probably benign Het
Kdm5b A T 1: 134,595,833 T249S probably benign Het
Klhl11 G T 11: 100,464,352 H214Q probably benign Het
L3hypdh A T 12: 72,084,931 Y76N probably damaging Het
Lama4 G T 10: 39,045,755 R424L possibly damaging Het
Lepr A G 4: 101,745,656 I214V probably benign Het
Lipc G T 9: 70,802,168 N432K probably benign Het
Lipm C T 19: 34,116,198 A216V possibly damaging Het
Lrrc23 A G 6: 124,779,125 S2P unknown Het
Lyst T A 13: 13,637,524 D840E probably benign Het
Mmp23 T A 4: 155,651,584 T204S probably damaging Het
Mms19 T C 19: 41,948,278 T785A probably benign Het
Mov10 A T 3: 104,800,052 probably null Het
Mtf2 A G 5: 108,100,970 T383A probably benign Het
Myo5c G A 9: 75,251,527 probably null Het
Nfxl1 A T 5: 72,524,174 C671* probably null Het
Npepps A G 11: 97,213,156 V813A probably benign Het
Nrn1 C A 13: 36,726,851 W69L probably damaging Het
Olfr231 A C 1: 174,117,187 F276L probably benign Het
Olfr543 A T 7: 102,477,676 Y65N probably damaging Het
Olfr656 C T 7: 104,617,852 H58Y probably damaging Het
Olfr663 T A 7: 104,703,589 D7E probably benign Het
Olfr694 T A 7: 106,689,210 I174F possibly damaging Het
Olfr771 A G 10: 129,160,751 Y78H possibly damaging Het
Olfr799 T C 10: 129,647,158 I10T probably damaging Het
Oprd1 A C 4: 132,114,067 D193E probably benign Het
Pcdhac1 G T 18: 37,092,497 V788L probably benign Het
Pcdhb11 G A 18: 37,423,260 V548M probably damaging Het
Pde4c A T 8: 70,748,972 E517V possibly damaging Het
Pdzd7 T C 19: 45,033,647 R521G possibly damaging Het
Pik3c2a T A 7: 116,372,854 K780N probably damaging Het
Plb1 T G 5: 32,321,247 probably null Het
Plcb4 T A 2: 136,000,219 L1041Q probably benign Het
Pnpla6 G A 8: 3,516,540 probably null Het
Ppat A T 5: 76,915,979 N441K probably damaging Het
Ppp1r1b G A 11: 98,355,479 A132T probably damaging Het
Prl2c2 A C 13: 12,997,480 probably null Het
Prr14 T C 7: 127,475,286 I330T probably benign Het
Pycr1 T C 11: 120,642,923 D36G probably benign Het
Rabep2 T A 7: 126,438,719 I221N probably damaging Het
Rad23b A G 4: 55,370,469 D165G probably benign Het
Reln G A 5: 21,971,953 T1905I probably damaging Het
Ripor2 T C 13: 24,694,205 V321A probably benign Het
Rnf43 A G 11: 87,731,852 D466G probably benign Het
Rpl6 A T 5: 121,205,592 R63W possibly damaging Het
S100a14 A G 3: 90,528,204 T102A probably benign Het
Samd11 C A 4: 156,249,400 V195L probably benign Het
Scaper G A 9: 55,762,277 Q372* probably null Het
Sec14l5 G T 16: 5,180,875 C593F probably damaging Het
Sema6d T C 2: 124,654,158 Y41H probably damaging Het
Serac1 G A 17: 6,069,314 R114W probably damaging Het
Slc12a4 T C 8: 105,950,836 E388G probably benign Het
Smarcd3 T C 5: 24,595,812 T164A probably benign Het
Smtn C A 11: 3,530,249 R324L probably benign Het
Spata31d1c C T 13: 65,035,361 P239L probably benign Het
Srcap T C 7: 127,538,517 V1013A possibly damaging Het
Sv2b T C 7: 75,124,064 N553S probably damaging Het
Tex35 T A 1: 157,105,086 N52I probably damaging Het
Ticrr T C 7: 79,693,986 S1200P probably benign Het
Tmem19 A G 10: 115,347,699 L125P probably damaging Het
Trio A G 15: 27,856,107 V666A probably benign Het
Ttn T C 2: 76,917,283 D4474G probably benign Het
Usp43 A T 11: 67,893,016 S368T possibly damaging Het
Vmn2r72 T A 7: 85,751,140 M234L probably benign Het
Wdr93 T A 7: 79,777,307 probably null Het
Wrap73 T A 4: 154,156,127 W359R probably damaging Het
Ywhah A G 5: 33,026,641 I63V probably benign Het
Zbtb7b G T 3: 89,381,059 P151T probably damaging Het
Zfp318 A G 17: 46,400,069 N906S probably damaging Het
Zfp423 C A 8: 87,780,713 C1001F probably damaging Het
Zmym1 A G 4: 127,049,398 I399T possibly damaging Het
Zmynd15 G A 11: 70,462,188 G296D probably benign Het
Znfx1 T A 2: 167,048,555 I670F probably damaging Het
Other mutations in Cdc42bpg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Cdc42bpg APN 19 6312205 splice site probably benign
IGL01415:Cdc42bpg APN 19 6310851 missense probably damaging 1.00
IGL01517:Cdc42bpg APN 19 6318437 missense probably damaging 1.00
IGL01585:Cdc42bpg APN 19 6320432 missense possibly damaging 0.93
IGL01743:Cdc42bpg APN 19 6309823 critical splice donor site probably null
IGL01930:Cdc42bpg APN 19 6311368 missense probably damaging 1.00
IGL02092:Cdc42bpg APN 19 6316826 splice site probably benign
IGL02355:Cdc42bpg APN 19 6310809 missense possibly damaging 0.93
IGL02362:Cdc42bpg APN 19 6310809 missense possibly damaging 0.93
IGL02498:Cdc42bpg APN 19 6322793 missense probably benign
IGL03004:Cdc42bpg APN 19 6311383 missense probably benign 0.38
IGL03037:Cdc42bpg APN 19 6311200 missense probably damaging 1.00
PIT1430001:Cdc42bpg UTSW 19 6322552 splice site probably null
R0304:Cdc42bpg UTSW 19 6317248 missense probably damaging 0.99
R0367:Cdc42bpg UTSW 19 6311395 missense probably damaging 1.00
R0412:Cdc42bpg UTSW 19 6313457 missense probably damaging 1.00
R0742:Cdc42bpg UTSW 19 6318575 critical splice donor site probably null
R1026:Cdc42bpg UTSW 19 6317187 missense probably damaging 1.00
R1056:Cdc42bpg UTSW 19 6314021 missense probably benign 0.10
R1065:Cdc42bpg UTSW 19 6322826 missense probably damaging 1.00
R1476:Cdc42bpg UTSW 19 6313782 missense probably damaging 0.99
R1854:Cdc42bpg UTSW 19 6320807 missense possibly damaging 0.67
R1936:Cdc42bpg UTSW 19 6310309 missense probably damaging 1.00
R1962:Cdc42bpg UTSW 19 6306855 missense probably damaging 1.00
R2070:Cdc42bpg UTSW 19 6320488 missense probably damaging 1.00
R2167:Cdc42bpg UTSW 19 6317677 missense probably damaging 1.00
R3826:Cdc42bpg UTSW 19 6317645 missense probably damaging 0.99
R3829:Cdc42bpg UTSW 19 6317645 missense probably damaging 0.99
R4190:Cdc42bpg UTSW 19 6321681 missense probably damaging 1.00
R4249:Cdc42bpg UTSW 19 6315266 missense possibly damaging 0.65
R4499:Cdc42bpg UTSW 19 6320555 missense possibly damaging 0.69
R4731:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4732:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4733:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4797:Cdc42bpg UTSW 19 6320447 missense probably damaging 1.00
R4831:Cdc42bpg UTSW 19 6311335 missense probably damaging 0.97
R4984:Cdc42bpg UTSW 19 6316223 missense possibly damaging 0.88
R5092:Cdc42bpg UTSW 19 6313220 missense probably benign 0.01
R5135:Cdc42bpg UTSW 19 6320618 missense probably damaging 1.00
R5183:Cdc42bpg UTSW 19 6321805 intron probably benign
R5208:Cdc42bpg UTSW 19 6321720 missense probably benign 0.01
R5240:Cdc42bpg UTSW 19 6315899 missense probably damaging 1.00
R5475:Cdc42bpg UTSW 19 6311071 missense probably damaging 0.99
R5703:Cdc42bpg UTSW 19 6322673 missense possibly damaging 0.87
R5876:Cdc42bpg UTSW 19 6310815 missense probably damaging 1.00
R6024:Cdc42bpg UTSW 19 6317496 missense probably damaging 1.00
R6266:Cdc42bpg UTSW 19 6311473 missense probably damaging 1.00
R6450:Cdc42bpg UTSW 19 6314488 splice site probably null
R6493:Cdc42bpg UTSW 19 6318455 missense probably damaging 0.96
R6983:Cdc42bpg UTSW 19 6321668 missense probably damaging 1.00
R7080:Cdc42bpg UTSW 19 6315189 missense probably damaging 0.97
R7125:Cdc42bpg UTSW 19 6322291 missense probably damaging 1.00
R7183:Cdc42bpg UTSW 19 6310797 missense probably damaging 1.00
R7317:Cdc42bpg UTSW 19 6314504 missense probably benign 0.11
R7504:Cdc42bpg UTSW 19 6306784 missense possibly damaging 0.85
R7530:Cdc42bpg UTSW 19 6322275 missense probably benign 0.21
R7530:Cdc42bpg UTSW 19 6322276 missense probably benign 0.12
R7739:Cdc42bpg UTSW 19 6310815 missense probably damaging 1.00
R7903:Cdc42bpg UTSW 19 6313469 missense possibly damaging 0.94
R8186:Cdc42bpg UTSW 19 6306865 missense probably damaging 1.00
R8331:Cdc42bpg UTSW 19 6313447 missense probably benign 0.08
Z1177:Cdc42bpg UTSW 19 6309746 missense probably damaging 1.00
Z1177:Cdc42bpg UTSW 19 6314522 missense possibly damaging 0.94
Z1177:Cdc42bpg UTSW 19 6314523 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTAGGCTCAGGAATTGC -3'
(R):5'- TTCAGCACACGACTTACCAATG -3'

Sequencing Primer
(F):5'- CACTAGGCTCAGGAATTGCTATTGC -3'
(R):5'- TGACAGCAGCACAGAGC -3'
Posted On2019-10-07