Incidental Mutation 'R7426:Pdzd7'
ID 576139
Institutional Source Beutler Lab
Gene Symbol Pdzd7
Ensembl Gene ENSMUSG00000074818
Gene Name PDZ domain containing 7
Synonyms EG435601, Pdzk7
MMRRC Submission 045504-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.247) question?
Stock # R7426 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 45015345-45034156 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45022086 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 521 (R521G)
Ref Sequence ENSEMBL: ENSMUSP00000119002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000145391] [ENSMUST00000169459]
AlphaFold E9Q9W7
Predicted Effect possibly damaging
Transcript: ENSMUST00000145391
AA Change: R521G

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000119002
Gene: ENSMUSG00000074818
AA Change: R521G

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
PDZ 95 167 3.51e-19 SMART
PDZ 220 292 2.47e-14 SMART
low complexity region 319 344 N/A INTRINSIC
low complexity region 442 459 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
low complexity region 724 744 N/A INTRINSIC
low complexity region 768 809 N/A INTRINSIC
low complexity region 812 824 N/A INTRINSIC
PDZ 866 947 1.96e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169459
AA Change: R521G

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133273
Gene: ENSMUSG00000074818
AA Change: R521G

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
PDZ 95 167 3.51e-19 SMART
PDZ 220 292 2.47e-14 SMART
low complexity region 319 344 N/A INTRINSIC
low complexity region 442 459 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
low complexity region 724 744 N/A INTRINSIC
low complexity region 768 809 N/A INTRINSIC
low complexity region 812 824 N/A INTRINSIC
PDZ 866 947 1.96e-8 SMART
Meta Mutation Damage Score 0.0748 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (114/118)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ciliary protein homologous to proteins which are mutated in Usher syndrome patients, and mutations and translocations involving this gene have been associated with two types of Usher syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit profound deafness due to abnormal outer cochlear hair cell morphology and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 C A 7: 119,945,221 (GRCm39) N432K possibly damaging Het
Abitram A G 4: 56,804,230 (GRCm39) I82V probably null Het
Adamtsl5 G A 10: 80,180,693 (GRCm39) T123I probably benign Het
Aff4 T C 11: 53,263,702 (GRCm39) S241P probably damaging Het
Agl A G 3: 116,552,404 (GRCm39) L510P Het
Aox1 A T 1: 58,329,142 (GRCm39) K196* probably null Het
Arhgef37 A G 18: 61,637,456 (GRCm39) L402P probably damaging Het
Arid4b T C 13: 14,355,891 (GRCm39) probably null Het
Atp5pb A G 3: 105,851,118 (GRCm39) V193A probably benign Het
Atp8b3 A G 10: 80,365,463 (GRCm39) probably null Het
Baz2a G T 10: 127,951,947 (GRCm39) R555L probably damaging Het
Casp4 G T 9: 5,321,345 (GRCm39) S32I possibly damaging Het
Cd300lb A G 11: 114,819,128 (GRCm39) V167A probably damaging Het
Cdc42bpg C T 19: 6,368,428 (GRCm39) T1042I probably damaging Het
Ceacam20 T C 7: 19,704,159 (GRCm39) F70S probably damaging Het
Cep162 C T 9: 87,074,819 (GRCm39) V1388I probably damaging Het
Cfap65 A G 1: 74,959,585 (GRCm39) V855A possibly damaging Het
Chil3 G T 3: 106,063,022 (GRCm39) D189E probably benign Het
Cln3 A G 7: 126,180,912 (GRCm39) I43T probably benign Het
Cntnap5a A G 1: 116,370,110 (GRCm39) Q909R probably benign Het
Ctsd C A 7: 141,937,278 (GRCm39) A77S probably damaging Het
Dnah12 T A 14: 26,445,781 (GRCm39) S781T probably benign Het
Dnah17 T A 11: 117,981,543 (GRCm39) Q1716L probably null Het
Dock3 C A 9: 106,772,782 (GRCm39) M490I probably benign Het
Erg T C 16: 95,260,015 (GRCm39) probably null Het
Farp2 A T 1: 93,548,950 (GRCm39) M1019L possibly damaging Het
Fcgbp A G 7: 27,785,949 (GRCm39) K462R probably benign Het
Fn1 A T 1: 71,688,384 (GRCm39) N173K probably damaging Het
Fsip2 A T 2: 82,810,441 (GRCm39) L2253F probably damaging Het
Gabrd C T 4: 155,469,970 (GRCm39) R413H possibly damaging Het
Galnt5 A T 2: 57,907,151 (GRCm39) D538V probably damaging Het
Gje1 T A 10: 14,592,223 (GRCm39) L186F probably damaging Het
Gm16686 A T 4: 88,673,563 (GRCm39) C89S unknown Het
Gna15 G T 10: 81,338,831 (GRCm39) A336E probably benign Het
Golga4 C T 9: 118,388,563 (GRCm39) S1895L probably benign Het
Gon4l A T 3: 88,814,829 (GRCm39) M1933L probably benign Het
Gpr183 T C 14: 122,192,156 (GRCm39) S122G possibly damaging Het
Gtf2h4 G A 17: 35,980,250 (GRCm39) T348I probably damaging Het
Hace1 T C 10: 45,481,636 (GRCm39) Y120H probably damaging Het
Hivep2 C T 10: 14,007,061 (GRCm39) H1220Y possibly damaging Het
Hmx2 T C 7: 131,156,232 (GRCm39) F66S probably benign Het
Hoxd12 A T 2: 74,505,569 (GRCm39) S47C possibly damaging Het
Hp C A 8: 110,301,832 (GRCm39) probably null Het
Idh3a T A 9: 54,508,492 (GRCm39) D355E probably benign Het
Itga2b A T 11: 102,347,120 (GRCm39) M921K probably benign Het
Jcad A G 18: 4,675,529 (GRCm39) D1097G probably benign Het
Kdm5b A T 1: 134,523,571 (GRCm39) T249S probably benign Het
Klhl11 G T 11: 100,355,178 (GRCm39) H214Q probably benign Het
L3hypdh A T 12: 72,131,705 (GRCm39) Y76N probably damaging Het
Lama4 G T 10: 38,921,751 (GRCm39) R424L possibly damaging Het
Lepr A G 4: 101,602,853 (GRCm39) I214V probably benign Het
Lipc G T 9: 70,709,450 (GRCm39) N432K probably benign Het
Lipm C T 19: 34,093,598 (GRCm39) A216V possibly damaging Het
Lrrc23 A G 6: 124,756,088 (GRCm39) S2P unknown Het
Lyst T A 13: 13,812,109 (GRCm39) D840E probably benign Het
Mmp23 T A 4: 155,736,041 (GRCm39) T204S probably damaging Het
Mms19 T C 19: 41,936,717 (GRCm39) T785A probably benign Het
Mov10 A T 3: 104,707,368 (GRCm39) probably null Het
Mtf2 A G 5: 108,248,836 (GRCm39) T383A probably benign Het
Myo5c G A 9: 75,158,809 (GRCm39) probably null Het
Nfxl1 A T 5: 72,681,517 (GRCm39) C671* probably null Het
Npepps A G 11: 97,103,982 (GRCm39) V813A probably benign Het
Nrn1 C A 13: 36,910,825 (GRCm39) W69L probably damaging Het
Oprd1 A C 4: 131,841,378 (GRCm39) D193E probably benign Het
Or2ag1b T A 7: 106,288,417 (GRCm39) I174F possibly damaging Het
Or52p1 C T 7: 104,267,059 (GRCm39) H58Y probably damaging Het
Or55b3 A T 7: 102,126,883 (GRCm39) Y65N probably damaging Het
Or56b2j T A 7: 104,352,796 (GRCm39) D7E probably benign Het
Or6c202 A G 10: 128,996,620 (GRCm39) Y78H possibly damaging Het
Or6c209 T C 10: 129,483,027 (GRCm39) I10T probably damaging Het
Or6k6 A C 1: 173,944,753 (GRCm39) F276L probably benign Het
Pcdhac1 G T 18: 37,225,550 (GRCm39) V788L probably benign Het
Pcdhb11 G A 18: 37,556,313 (GRCm39) V548M probably damaging Het
Pde4c A T 8: 71,201,621 (GRCm39) E517V possibly damaging Het
Pik3c2a T A 7: 115,972,089 (GRCm39) K780N probably damaging Het
Plb1 T G 5: 32,478,591 (GRCm39) probably null Het
Plcb4 T A 2: 135,842,139 (GRCm39) L1041Q probably benign Het
Pnpla6 G A 8: 3,566,540 (GRCm39) probably null Het
Ppat A T 5: 77,063,826 (GRCm39) N441K probably damaging Het
Ppp1r1b G A 11: 98,246,305 (GRCm39) A132T probably damaging Het
Prl2c2 A C 13: 13,172,065 (GRCm39) probably null Het
Prr14 T C 7: 127,074,458 (GRCm39) I330T probably benign Het
Pycr1 T C 11: 120,533,749 (GRCm39) D36G probably benign Het
Rabep2 T A 7: 126,037,891 (GRCm39) I221N probably damaging Het
Rad23b A G 4: 55,370,469 (GRCm39) D165G probably benign Het
Reln G A 5: 22,176,951 (GRCm39) T1905I probably damaging Het
Ripor2 T C 13: 24,878,188 (GRCm39) V321A probably benign Het
Rnf43 A G 11: 87,622,678 (GRCm39) D466G probably benign Het
Rpl6 A T 5: 121,343,655 (GRCm39) R63W possibly damaging Het
S100a14 A G 3: 90,435,511 (GRCm39) T102A probably benign Het
Samd11 C A 4: 156,333,857 (GRCm39) V195L probably benign Het
Scaper G A 9: 55,669,561 (GRCm39) Q372* probably null Het
Sec14l5 G T 16: 4,998,739 (GRCm39) C593F probably damaging Het
Sema6d T C 2: 124,496,078 (GRCm39) Y41H probably damaging Het
Serac1 G A 17: 6,119,589 (GRCm39) R114W probably damaging Het
Slc12a4 T C 8: 106,677,468 (GRCm39) E388G probably benign Het
Smarcd3 T C 5: 24,800,810 (GRCm39) T164A probably benign Het
Smtn C A 11: 3,480,249 (GRCm39) R324L probably benign Het
Spata31d1c C T 13: 65,183,175 (GRCm39) P239L probably benign Het
Srcap T C 7: 127,137,689 (GRCm39) V1013A possibly damaging Het
Sv2b T C 7: 74,773,812 (GRCm39) N553S probably damaging Het
Tex35 T A 1: 156,932,656 (GRCm39) N52I probably damaging Het
Ticrr T C 7: 79,343,734 (GRCm39) S1200P probably benign Het
Tmem19 A G 10: 115,183,604 (GRCm39) L125P probably damaging Het
Trio A G 15: 27,856,193 (GRCm39) V666A probably benign Het
Ttn T C 2: 76,747,627 (GRCm39) D4474G probably benign Het
Usp43 A T 11: 67,783,842 (GRCm39) S368T possibly damaging Het
Vmn2r72 T A 7: 85,400,348 (GRCm39) M234L probably benign Het
Wdr93 T A 7: 79,427,055 (GRCm39) probably null Het
Wrap73 T A 4: 154,240,584 (GRCm39) W359R probably damaging Het
Ywhah A G 5: 33,183,985 (GRCm39) I63V probably benign Het
Zbtb7b G T 3: 89,288,366 (GRCm39) P151T probably damaging Het
Zfp318 A G 17: 46,710,995 (GRCm39) N906S probably damaging Het
Zfp423 C A 8: 88,507,341 (GRCm39) C1001F probably damaging Het
Zmym1 A G 4: 126,943,191 (GRCm39) I399T possibly damaging Het
Zmynd15 G A 11: 70,353,014 (GRCm39) G296D probably benign Het
Znfx1 T A 2: 166,890,475 (GRCm39) I670F probably damaging Het
Other mutations in Pdzd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02237:Pdzd7 APN 19 45,028,697 (GRCm39) missense probably damaging 1.00
IGL02729:Pdzd7 APN 19 45,034,082 (GRCm39) start codon destroyed probably null 0.89
F6893:Pdzd7 UTSW 19 45,025,173 (GRCm39) missense probably damaging 0.98
R0211:Pdzd7 UTSW 19 45,022,106 (GRCm39) missense possibly damaging 0.72
R0211:Pdzd7 UTSW 19 45,022,106 (GRCm39) missense possibly damaging 0.72
R0295:Pdzd7 UTSW 19 45,025,511 (GRCm39) missense probably benign 0.01
R0523:Pdzd7 UTSW 19 45,024,529 (GRCm39) missense probably benign 0.01
R0645:Pdzd7 UTSW 19 45,033,914 (GRCm39) missense possibly damaging 0.95
R0731:Pdzd7 UTSW 19 45,017,744 (GRCm39) missense probably damaging 1.00
R1265:Pdzd7 UTSW 19 45,029,124 (GRCm39) missense possibly damaging 0.64
R1711:Pdzd7 UTSW 19 45,033,950 (GRCm39) missense possibly damaging 0.68
R1789:Pdzd7 UTSW 19 45,027,667 (GRCm39) missense probably damaging 1.00
R1817:Pdzd7 UTSW 19 45,024,615 (GRCm39) missense probably damaging 0.98
R2162:Pdzd7 UTSW 19 45,024,494 (GRCm39) critical splice donor site probably null
R2851:Pdzd7 UTSW 19 45,016,113 (GRCm39) missense probably benign
R2852:Pdzd7 UTSW 19 45,016,113 (GRCm39) missense probably benign
R2939:Pdzd7 UTSW 19 45,033,862 (GRCm39) missense possibly damaging 0.89
R3832:Pdzd7 UTSW 19 45,028,693 (GRCm39) missense probably damaging 1.00
R3874:Pdzd7 UTSW 19 45,034,067 (GRCm39) missense probably benign
R4416:Pdzd7 UTSW 19 45,029,019 (GRCm39) missense probably damaging 1.00
R4668:Pdzd7 UTSW 19 45,034,126 (GRCm39) start gained probably benign
R5133:Pdzd7 UTSW 19 45,016,868 (GRCm39) missense possibly damaging 0.51
R5327:Pdzd7 UTSW 19 45,017,216 (GRCm39) missense probably benign
R5458:Pdzd7 UTSW 19 45,016,230 (GRCm39) missense probably benign
R5480:Pdzd7 UTSW 19 45,027,724 (GRCm39) missense possibly damaging 0.65
R5644:Pdzd7 UTSW 19 45,028,619 (GRCm39) missense probably benign 0.16
R5799:Pdzd7 UTSW 19 45,025,428 (GRCm39) missense probably benign 0.06
R5812:Pdzd7 UTSW 19 45,025,310 (GRCm39) missense probably damaging 1.00
R5873:Pdzd7 UTSW 19 45,016,388 (GRCm39) missense probably damaging 1.00
R6669:Pdzd7 UTSW 19 45,025,190 (GRCm39) missense possibly damaging 0.94
R6750:Pdzd7 UTSW 19 45,016,187 (GRCm39) missense probably benign
R7128:Pdzd7 UTSW 19 45,016,388 (GRCm39) missense probably damaging 0.99
R7183:Pdzd7 UTSW 19 45,025,553 (GRCm39) missense probably benign
R7378:Pdzd7 UTSW 19 45,034,045 (GRCm39) missense probably damaging 0.99
R7395:Pdzd7 UTSW 19 45,025,450 (GRCm39) missense probably damaging 1.00
R7790:Pdzd7 UTSW 19 45,033,962 (GRCm39) nonsense probably null
R7792:Pdzd7 UTSW 19 45,028,657 (GRCm39) missense possibly damaging 0.54
R7829:Pdzd7 UTSW 19 45,027,678 (GRCm39) missense probably benign 0.00
R7883:Pdzd7 UTSW 19 45,018,679 (GRCm39) missense probably damaging 1.00
R7969:Pdzd7 UTSW 19 45,024,664 (GRCm39) missense probably benign 0.01
R8387:Pdzd7 UTSW 19 45,018,490 (GRCm39) missense probably damaging 1.00
R8720:Pdzd7 UTSW 19 45,024,667 (GRCm39) missense probably benign 0.27
R8830:Pdzd7 UTSW 19 45,021,512 (GRCm39) missense probably damaging 1.00
R9282:Pdzd7 UTSW 19 45,028,622 (GRCm39) missense probably damaging 0.96
R9417:Pdzd7 UTSW 19 45,034,022 (GRCm39) missense probably damaging 1.00
R9453:Pdzd7 UTSW 19 45,016,056 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- CCAGTTGGAGTATAGACACACTC -3'
(R):5'- ACTCCCCACTGCCTTTAAGG -3'

Sequencing Primer
(F):5'- ACCCCACATCCCTTTGGG -3'
(R):5'- AGGTCAGTCCCTAGCTGGATATGAC -3'
Posted On 2019-10-07