Incidental Mutation 'R7427:Sned1'
ID 576140
Institutional Source Beutler Lab
Gene Symbol Sned1
Ensembl Gene ENSMUSG00000047793
Gene Name sushi, nidogen and EGF-like domains 1
Synonyms D430044C15Rik, 6720455I24Rik, Snep
MMRRC Submission 045505-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R7427 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 93163563-93228787 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 93217080 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 1322 (V1322I)
Ref Sequence ENSEMBL: ENSMUSP00000050832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062202]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000062202
AA Change: V1322I

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000050832
Gene: ENSMUSG00000047793
AA Change: V1322I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
NIDO 103 260 2.98e-54 SMART
EGF 271 309 3.79e-6 SMART
EGF_CA 311 347 2.42e-13 SMART
EGF 352 385 1.02e-6 SMART
EGF_CA 387 423 1.91e-11 SMART
EGF 432 465 2.96e-8 SMART
EGF 471 500 6.02e0 SMART
EGF 544 577 3.54e-6 SMART
EGF 583 616 6.06e-5 SMART
EGF_CA 619 655 2.33e-6 SMART
EGF 660 693 1.77e-6 SMART
CCP 698 751 2.5e-11 SMART
EGF_CA 753 789 1.66e-11 SMART
EGF_CA 791 827 1.38e-8 SMART
EGF_CA 829 865 1.92e-7 SMART
EGF 870 903 2.35e-2 SMART
FN3 906 991 1.7e-4 SMART
FN3 1005 1084 1.38e-4 SMART
FN3 1104 1185 1.6e-9 SMART
EGF 1309 1342 6.16e-6 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000132455
Gene: ENSMUSG00000047793
AA Change: V499I

DomainStartEndE-ValueType
EGF_CA 1 37 6.7e-7 SMART
EGF_CA 39 75 1.92e-7 SMART
EGF 80 113 2.35e-2 SMART
FN3 116 201 1.7e-4 SMART
FN3 215 294 1.38e-4 SMART
FN3 314 395 1.6e-9 SMART
EGF 487 520 6.16e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (78/78)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck5 T A 15: 76,478,585 (GRCm39) C318S possibly damaging Het
Aspm T A 1: 139,385,354 (GRCm39) C333S probably benign Het
B3gnt4 A G 5: 123,648,794 (GRCm39) N53S probably damaging Het
Bpifb5 G A 2: 154,067,042 (GRCm39) M98I probably benign Het
Cacna2d3 A G 14: 28,786,232 (GRCm39) M585T probably damaging Het
Cbarp T C 10: 79,967,138 (GRCm39) D701G probably damaging Het
Ccn2 T G 10: 24,473,397 (GRCm39) M312R probably damaging Het
Cntrl T A 2: 35,060,546 (GRCm39) W1913R probably benign Het
Cry2 T C 2: 92,243,392 (GRCm39) D483G possibly damaging Het
Csmd1 A G 8: 16,073,864 (GRCm39) F2044L possibly damaging Het
Cxcl16 A G 11: 70,349,630 (GRCm39) V78A possibly damaging Het
Cxcr6 A T 9: 123,639,305 (GRCm39) Y109F probably benign Het
Cyb5b A G 8: 107,897,048 (GRCm39) D106G probably benign Het
D630036H23Rik T C 12: 36,431,537 (GRCm39) R154G unknown Het
Dnah9 T C 11: 65,846,045 (GRCm39) T2998A probably benign Het
Focad T C 4: 88,286,988 (GRCm39) S1254P unknown Het
Gm21886 A T 18: 80,132,867 (GRCm39) L97Q probably damaging Het
Gpr158 A C 2: 21,832,129 (GRCm39) L1076F probably benign Het
Hivep2 T C 10: 14,009,485 (GRCm39) M1714T possibly damaging Het
Hlcs A G 16: 94,068,758 (GRCm39) V154A probably benign Het
Hpdl A T 4: 116,678,062 (GRCm39) L133Q probably damaging Het
Il1rn C A 2: 24,239,554 (GRCm39) T150K probably benign Het
Il6st A G 13: 112,625,094 (GRCm39) I237V probably benign Het
Inpp5f A G 7: 128,281,529 (GRCm39) D510G probably damaging Het
Ism2 G T 12: 87,333,769 (GRCm39) T92K possibly damaging Het
Kif13b T C 14: 65,025,909 (GRCm39) I1422T probably benign Het
Kit G A 5: 75,806,507 (GRCm39) V671I possibly damaging Het
Klhdc8a A T 1: 132,230,705 (GRCm39) N190I probably damaging Het
Lad1 C T 1: 135,753,576 (GRCm39) T41I probably damaging Het
Lrrc7 G T 3: 157,903,778 (GRCm39) T294K probably benign Het
Megf8 C T 7: 25,037,796 (GRCm39) R771C probably benign Het
Micu3 A C 8: 40,831,955 (GRCm39) N440T possibly damaging Het
Mnx1 T C 5: 29,679,211 (GRCm39) N291D unknown Het
Mthfr A G 4: 148,136,060 (GRCm39) M378V probably benign Het
Mup2 A T 4: 60,138,454 (GRCm39) D79E probably benign Het
Myzap T C 9: 71,412,465 (GRCm39) T451A probably benign Het
Nlrp9c T C 7: 26,070,860 (GRCm39) D907G probably benign Het
Nr1h4 T C 10: 89,334,267 (GRCm39) E41G probably benign Het
Nup98 A T 7: 101,784,208 (GRCm39) probably null Het
Nxpe5 A C 5: 138,238,022 (GRCm39) Y194S probably damaging Het
Omd A T 13: 49,745,745 (GRCm39) E385V possibly damaging Het
Or12d15 T C 17: 37,694,190 (GRCm39) V244A probably damaging Het
Or12e9 G T 2: 87,202,034 (GRCm39) V53L probably benign Het
Or2av9 A G 11: 58,380,606 (GRCm39) I325T probably benign Het
Or52m1 A G 7: 102,289,533 (GRCm39) I27V probably benign Het
Or5m12 T A 2: 85,734,475 (GRCm39) R308* probably null Het
Or5m3 A T 2: 85,838,563 (GRCm39) I148L probably benign Het
Or9s18 A G 13: 65,300,866 (GRCm39) Y276C probably damaging Het
Pcdh9 G T 14: 94,124,547 (GRCm39) T541K probably damaging Het
Pdia6 T C 12: 17,328,546 (GRCm39) V167A probably damaging Het
Phf7 C T 14: 30,962,370 (GRCm39) R145Q possibly damaging Het
Pitx3 T C 19: 46,125,863 (GRCm39) D20G possibly damaging Het
Plxnb1 T C 9: 108,937,236 (GRCm39) V1139A probably benign Het
Pon2 A T 6: 5,268,995 (GRCm39) N226K probably damaging Het
Potegl C T 2: 23,147,006 (GRCm39) R337C probably benign Het
Ppp1r10 T A 17: 36,241,025 (GRCm39) H642Q possibly damaging Het
Prom2 A G 2: 127,381,731 (GRCm39) L195P probably damaging Het
Psg23 C T 7: 18,345,908 (GRCm39) probably null Het
Rfx4 C A 10: 84,731,876 (GRCm39) Q618K probably benign Het
Rhobtb1 T A 10: 69,084,654 (GRCm39) I15N probably damaging Het
Rhot2 A T 17: 26,060,583 (GRCm39) V233E probably damaging Het
Ripply2 T C 9: 86,901,809 (GRCm39) S112P possibly damaging Het
Slc12a1 C A 2: 125,056,052 (GRCm39) T861N probably benign Het
Slc35f1 T A 10: 52,965,510 (GRCm39) S308R probably damaging Het
Slc35f4 T A 14: 49,536,355 (GRCm39) I427F probably damaging Het
Slco1a8 T G 6: 141,949,234 (GRCm39) probably null Het
Sprr2f G A 3: 92,273,251 (GRCm39) V17M unknown Het
Srd5a3 A G 5: 76,302,490 (GRCm39) H285R probably benign Het
Stab1 T C 14: 30,881,216 (GRCm39) T605A probably benign Het
Syne1 T C 10: 5,223,718 (GRCm39) Q3054R probably damaging Het
Tas1r1 T C 4: 152,122,765 (GRCm39) T27A probably benign Het
Tmem150b A T 7: 4,719,209 (GRCm39) V237E probably benign Het
Trpv6 C T 6: 41,602,087 (GRCm39) M407I probably benign Het
Ttn T G 2: 76,550,698 (GRCm39) D31528A probably damaging Het
Uroc1 A T 6: 90,323,344 (GRCm39) D354V possibly damaging Het
Vmn2r69 T C 7: 85,060,467 (GRCm39) I372M probably benign Het
Vmn2r93 A T 17: 18,546,672 (GRCm39) H848L probably benign Het
Zfp971 T A 2: 177,674,967 (GRCm39) C189S probably damaging Het
Other mutations in Sned1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Sned1 APN 1 93,201,891 (GRCm39) splice site probably benign
IGL00955:Sned1 APN 1 93,202,125 (GRCm39) missense probably damaging 1.00
IGL01367:Sned1 APN 1 93,210,936 (GRCm39) missense probably benign 0.32
IGL02116:Sned1 APN 1 93,209,447 (GRCm39) nonsense probably null
IGL02195:Sned1 APN 1 93,201,882 (GRCm39) missense probably benign 0.03
IGL02390:Sned1 APN 1 93,189,386 (GRCm39) missense probably benign
IGL02423:Sned1 APN 1 93,211,322 (GRCm39) missense probably benign
IGL02451:Sned1 APN 1 93,163,930 (GRCm39) splice site probably benign
IGL02567:Sned1 APN 1 93,202,069 (GRCm39) missense probably damaging 0.96
IGL03184:Sned1 APN 1 93,202,390 (GRCm39) missense probably benign 0.01
IGL03328:Sned1 APN 1 93,217,089 (GRCm39) missense probably benign
Bulger UTSW 1 93,199,385 (GRCm39) nonsense probably null
farina UTSW 1 93,209,374 (GRCm39) missense probably damaging 1.00
Millet UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
triticale UTSW 1 93,281,654 (GRCm39) missense
R0257:Sned1 UTSW 1 93,192,819 (GRCm39) missense possibly damaging 0.75
R0372:Sned1 UTSW 1 93,213,673 (GRCm39) splice site probably benign
R0525:Sned1 UTSW 1 93,199,696 (GRCm39) splice site probably null
R0727:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R0759:Sned1 UTSW 1 93,200,286 (GRCm39) missense probably damaging 1.00
R0965:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R0968:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R0969:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R1006:Sned1 UTSW 1 93,184,114 (GRCm39) missense probably damaging 1.00
R1068:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R1069:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R1070:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R1112:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R1113:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R1114:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R1115:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R1118:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R1119:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R1144:Sned1 UTSW 1 93,208,298 (GRCm39) missense probably damaging 0.98
R1228:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R1230:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R1231:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R1313:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R1313:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R1340:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R1382:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R1383:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R1394:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R1395:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R1397:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R1414:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R1430:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R1432:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R1473:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R1503:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R1563:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R1565:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R1689:Sned1 UTSW 1 93,211,094 (GRCm39) missense probably damaging 0.99
R1695:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R1734:Sned1 UTSW 1 93,187,490 (GRCm39) missense probably damaging 1.00
R1764:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R1767:Sned1 UTSW 1 93,209,376 (GRCm39) missense possibly damaging 0.89
R1896:Sned1 UTSW 1 93,192,769 (GRCm39) missense probably benign 0.16
R1916:Sned1 UTSW 1 93,201,884 (GRCm39) missense probably null 1.00
R1945:Sned1 UTSW 1 93,198,960 (GRCm39) missense probably benign 0.01
R1972:Sned1 UTSW 1 93,192,795 (GRCm39) missense probably damaging 1.00
R1973:Sned1 UTSW 1 93,192,795 (GRCm39) missense probably damaging 1.00
R2143:Sned1 UTSW 1 93,199,406 (GRCm39) missense probably damaging 1.00
R2144:Sned1 UTSW 1 93,199,406 (GRCm39) missense probably damaging 1.00
R2145:Sned1 UTSW 1 93,199,406 (GRCm39) missense probably damaging 1.00
R2153:Sned1 UTSW 1 93,202,379 (GRCm39) missense probably benign 0.01
R2273:Sned1 UTSW 1 93,209,364 (GRCm39) splice site probably null
R2274:Sned1 UTSW 1 93,209,364 (GRCm39) splice site probably null
R2275:Sned1 UTSW 1 93,209,364 (GRCm39) splice site probably null
R2340:Sned1 UTSW 1 93,184,174 (GRCm39) missense probably damaging 0.98
R3237:Sned1 UTSW 1 93,186,725 (GRCm39) missense probably benign 0.21
R3747:Sned1 UTSW 1 93,189,473 (GRCm39) missense probably damaging 1.00
R3879:Sned1 UTSW 1 93,192,752 (GRCm39) splice site probably benign
R4281:Sned1 UTSW 1 93,213,577 (GRCm39) nonsense probably null
R4282:Sned1 UTSW 1 93,213,577 (GRCm39) nonsense probably null
R4356:Sned1 UTSW 1 93,193,113 (GRCm39) splice site probably null
R4358:Sned1 UTSW 1 93,202,381 (GRCm39) missense probably benign 0.01
R4677:Sned1 UTSW 1 93,224,019 (GRCm39) unclassified probably benign
R5291:Sned1 UTSW 1 93,223,446 (GRCm39) missense possibly damaging 0.80
R5340:Sned1 UTSW 1 93,210,479 (GRCm39) missense probably benign 0.09
R5542:Sned1 UTSW 1 93,199,324 (GRCm39) missense probably benign
R5582:Sned1 UTSW 1 93,210,083 (GRCm39) missense probably damaging 1.00
R5874:Sned1 UTSW 1 93,193,067 (GRCm39) missense probably damaging 1.00
R6159:Sned1 UTSW 1 93,210,659 (GRCm39) missense probably benign 0.00
R6175:Sned1 UTSW 1 93,203,196 (GRCm39) splice site probably null
R6445:Sned1 UTSW 1 93,211,318 (GRCm39) missense possibly damaging 0.89
R6631:Sned1 UTSW 1 93,209,374 (GRCm39) missense probably damaging 1.00
R7018:Sned1 UTSW 1 93,212,143 (GRCm39) missense probably damaging 1.00
R7035:Sned1 UTSW 1 93,189,852 (GRCm39) missense probably damaging 1.00
R7047:Sned1 UTSW 1 93,213,540 (GRCm39) missense possibly damaging 0.51
R7347:Sned1 UTSW 1 93,209,458 (GRCm39) missense probably damaging 1.00
R7581:Sned1 UTSW 1 93,184,267 (GRCm39) missense probably benign 0.00
R7679:Sned1 UTSW 1 93,163,760 (GRCm39) missense unknown
R7899:Sned1 UTSW 1 93,201,804 (GRCm39) missense probably benign 0.04
R8093:Sned1 UTSW 1 93,202,387 (GRCm39) missense possibly damaging 0.82
R8124:Sned1 UTSW 1 93,210,711 (GRCm39) critical splice donor site probably null
R8489:Sned1 UTSW 1 93,210,978 (GRCm39) nonsense probably null
R9012:Sned1 UTSW 1 93,212,320 (GRCm39) missense probably damaging 0.99
R9290:Sned1 UTSW 1 93,199,385 (GRCm39) nonsense probably null
R9560:Sned1 UTSW 1 93,202,110 (GRCm39) missense probably damaging 1.00
R9775:Sned1 UTSW 1 93,199,604 (GRCm39) missense probably damaging 0.99
X0025:Sned1 UTSW 1 93,189,409 (GRCm39) missense probably damaging 1.00
Z1176:Sned1 UTSW 1 93,186,764 (GRCm39) missense probably damaging 1.00
Z1177:Sned1 UTSW 1 93,213,542 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCAGTGTCTGACAACAGGAG -3'
(R):5'- GAGATGTTGCTTTGGAATCACC -3'

Sequencing Primer
(F):5'- GGAAGACAGGTTTGCCGCTG -3'
(R):5'- GACTTCCTAGGCTTTATTCTGCAGTG -3'
Posted On 2019-10-07