Mutagenetix > Incidental Mutation

Incidental Mutation 'R7427:Aspm'

576143

Institutional Source

Beutler Lab

Gene Symbol

Aspm

Ensembl Gene

ENSMUSG00000033952

Gene Name

abnormal spindle microtubule assembly

Synonyms

Aspm, Sha1, MCPH5, D330028K02Rik, Calmbp1

MMRRC Submission

Accession Numbers

Genbank: NM_009791; MGI: 1334448

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7427 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

139454772-139494091 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 139457616 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 333 (C333S)

Ref Sequence

ENSEMBL: ENSMUSP00000059159 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039867] [ENSMUST00000053364] [ENSMUST00000200083]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000039867

SMART Domains

Protein: ENSMUSP00000045570
Gene: ENSMUSG00000033964

Domain	Start	End	E-Value	Type
low complexity region	70	81	N/A	INTRINSIC
BTB	89	183	7.06e-16	SMART
ZnF_C2H2	208	231	3.78e-1	SMART
low complexity region	234	245	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	301	327	N/A	INTRINSIC
ZnF_C2H2	360	382	4.17e-3	SMART
ZnF_C2H2	388	410	8.34e-3	SMART
ZnF_C2H2	421	444	2.67e-1	SMART
ZnF_C2H2	462	484	1.72e-4	SMART
ZnF_C2H2	490	513	1.41e0	SMART
ZnF_C2H2	517	540	1.12e-3	SMART
ZnF_C2H2	546	568	1.36e-2	SMART
ZnF_C2H2	574	596	2.91e-2	SMART
ZnF_C2H2	602	624	7.37e-4	SMART
ZnF_C2H2	630	653	3.39e-3	SMART
ZnF_C2H2	667	689	2.75e-3	SMART
ZnF_C2H2	695	717	3.16e-3	SMART
ZnF_C2H2	723	746	3.34e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000053364
AA Change: C333S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000059159
Gene: ENSMUSG00000033952
AA Change: C333S

Domain	Start	End	E-Value	Type
Pfam:ASH	29	126	8.9e-35	PFAM
low complexity region	855	861	N/A	INTRINSIC
CH	890	1022	2.04e0	SMART
CH	1080	1224	5.56e-9	SMART
IQ	1233	1255	7.57e0	SMART
IQ	1259	1281	1.12e1	SMART
IQ	1282	1304	3.73e-1	SMART
IQ	1314	1336	2.41e-4	SMART
IQ	1360	1382	2.12e1	SMART
IQ	1387	1408	7.61e1	SMART
IQ	1409	1431	6.97e0	SMART
IQ	1432	1452	1.44e1	SMART
IQ	1453	1475	1.15e-1	SMART
IQ	1476	1495	1.66e2	SMART
IQ	1503	1525	1.65e-2	SMART
IQ	1526	1548	1.32e1	SMART
IQ	1549	1571	1.48e1	SMART
IQ	1572	1594	2.5e1	SMART
IQ	1599	1621	2.58e-4	SMART
IQ	1622	1644	6.7e-3	SMART
IQ	1645	1667	4.25e1	SMART
IQ	1668	1694	1.03e2	SMART
IQ	1695	1717	2.33e-2	SMART
IQ	1718	1740	7.79e0	SMART
IQ	1741	1763	1.57e2	SMART
IQ	1768	1790	2.68e-2	SMART
IQ	1791	1813	5.83e-3	SMART
IQ	1814	1836	5.93e1	SMART
IQ	1841	1863	1.92e-3	SMART
IQ	1864	1886	3.79e-2	SMART
IQ	1914	1936	4.11e0	SMART
IQ	1937	1959	1.87e-1	SMART
IQ	1960	1982	6.27e1	SMART
IQ	1987	2009	8.25e-3	SMART
IQ	2010	2032	5.73e0	SMART
IQ	2060	2082	1.39e0	SMART
IQ	2083	2105	4.62e1	SMART
IQ	2133	2155	5.58e0	SMART
IQ	2156	2178	7.07e-2	SMART
IQ	2206	2228	1.18e-3	SMART
IQ	2229	2251	4.59e0	SMART
IQ	2278	2300	1.85e-5	SMART
IQ	2301	2323	8.13e-2	SMART
IQ	2342	2364	9.62e-4	SMART
IQ	2365	2387	4.12e-3	SMART
IQ	2415	2437	7.58e-2	SMART
IQ	2438	2460	2.6e0	SMART
IQ	2490	2512	1.68e-3	SMART
IQ	2513	2535	8.51e1	SMART
IQ	2560	2582	2.14e-1	SMART
IQ	2601	2623	8.46e0	SMART
IQ	2647	2669	1.15e1	SMART
IQ	2673	2695	1.95e-4	SMART
IQ	2696	2718	4.13e1	SMART
IQ	2723	2745	1.02e-2	SMART
IQ	2761	2783	3.14e2	SMART
IQ	2784	2806	1e1	SMART
IQ	2825	2847	2.43e0	SMART
IQ	2848	2870	4.6e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000200083
AA Change: C333S

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000142880
Gene: ENSMUSG00000033952
AA Change: C333S

Domain	Start	End	E-Value	Type
low complexity region	855	861	N/A	INTRINSIC
CH	890	1022	2.04e0	SMART
CH	1080	1224	5.56e-9	SMART
IQ	1233	1255	7.57e0	SMART
IQ	1259	1281	1.12e1	SMART
IQ	1282	1304	3.73e-1	SMART
IQ	1314	1336	1.25e1	SMART
IQ	1337	1358	2.96e1	SMART
IQ	1382	1404	1.15e1	SMART
IQ	1408	1430	1.95e-4	SMART
IQ	1431	1453	4.13e1	SMART
IQ	1458	1480	1.02e-2	SMART
IQ	1496	1518	3.14e2	SMART
IQ	1519	1541	1e1	SMART
IQ	1560	1582	2.43e0	SMART
IQ	1583	1605	4.6e-1	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (78/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the human ortholog of the Drosophila melanogaster 'abnormal spindle' gene (asp), which is essential for normal mitotic spindle function in embryonic neuroblasts. Studies in mouse also suggest a role of this gene in mitotic spindle regulation, with a preferential role in regulating neurogenesis. Mutations in this gene are associated with microcephaly primary type 5. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for protein-truncating gene trap mutations of this gene exhibit decreased body weight, microcephaly, a severe reduction in brain, testis and ovary weight, oligozoospermia and asthenospermia, and reduced fertility in both sexes. [provided by MGI curators]

Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931423N10Rik	C	T	2: 23,256,994	R337C	probably benign	Het
Adck5	T	A	15: 76,594,385	C318S	possibly damaging	Het
B3gnt4	A	G	5: 123,510,731	N53S	probably damaging	Het
Bpifb5	G	A	2: 154,225,122	M98I	probably benign	Het
Cacna2d3	A	G	14: 29,064,275	M585T	probably damaging	Het
Cbarp	T	C	10: 80,131,304	D701G	probably damaging	Het
Cntrl	T	A	2: 35,170,534	W1913R	probably benign	Het
Cry2	T	C	2: 92,413,047	D483G	possibly damaging	Het
Csmd1	A	G	8: 16,023,850	F2044L	possibly damaging	Het
Ctgf	T	G	10: 24,597,499	M312R	probably damaging	Het
Cxcl16	A	G	11: 70,458,804	V78A	possibly damaging	Het
Cxcr6	A	T	9: 123,810,240	Y109F	probably benign	Het
Cyb5b	A	G	8: 107,170,416	D106G	probably benign	Het
D630036H23Rik	T	C	12: 36,381,538	R154G	unknown	Het
Dnah9	T	C	11: 65,955,219	T2998A	probably benign	Het
Focad	T	C	4: 88,368,751	S1254P	unknown	Het
Gm21886	A	T	18: 80,089,652	L97Q	probably damaging	Het
Gm6614	T	G	6: 142,003,508		probably null	Het
Gpr158	A	C	2: 21,827,318	L1076F	probably benign	Het
Hivep2	T	C	10: 14,133,741	M1714T	possibly damaging	Het
Hlcs	A	G	16: 94,267,899	V154A	probably benign	Het
Hpdl	A	T	4: 116,820,865	L133Q	probably damaging	Het
Il1rn	C	A	2: 24,349,542	T150K	probably benign	Het
Il6st	A	G	13: 112,488,560	I237V	probably benign	Het
Inpp5f	A	G	7: 128,679,805	D510G	probably damaging	Het
Ism2	G	T	12: 87,286,995	T92K	possibly damaging	Het
Kif13b	T	C	14: 64,788,460	I1422T	probably benign	Het
Kit	G	A	5: 75,645,847	V671I	possibly damaging	Het
Klhdc8a	A	T	1: 132,302,967	N190I	probably damaging	Het
Lad1	C	T	1: 135,825,838	T41I	probably damaging	Het
Lrrc7	G	T	3: 158,198,141	T294K	probably benign	Het
Megf8	C	T	7: 25,338,371	R771C	probably benign	Het
Micu3	A	C	8: 40,378,914	N440T	possibly damaging	Het
Mnx1	T	C	5: 29,474,213	N291D	unknown	Het
Mthfr	A	G	4: 148,051,603	M378V	probably benign	Het
Mup2	A	T	4: 60,138,454	D79E	probably benign	Het
Myzap	T	C	9: 71,505,183	T451A	probably benign	Het
Nlrp9c	T	C	7: 26,371,435	D907G	probably benign	Het
Nr1h4	T	C	10: 89,498,405	E41G	probably benign	Het
Nup98	A	T	7: 102,135,001		probably null	Het
Nxpe5	A	C	5: 138,239,760	Y194S	probably damaging	Het
Olfr1024	T	A	2: 85,904,131	R308*	probably null	Het
Olfr1032	A	T	2: 86,008,219	I148L	probably benign	Het
Olfr105-ps	T	C	17: 37,383,299	V244A	probably damaging	Het
Olfr1121	G	T	2: 87,371,690	V53L	probably benign	Het
Olfr332	A	G	11: 58,489,780	I325T	probably benign	Het
Olfr466	A	G	13: 65,153,052	Y276C	probably damaging	Het
Olfr554	A	G	7: 102,640,326	I27V	probably benign	Het
Omd	A	T	13: 49,592,269	E385V	possibly damaging	Het
Pcdh9	G	T	14: 93,887,111	T541K	probably damaging	Het
Pdia6	T	C	12: 17,278,545	V167A	probably damaging	Het
Phf7	C	T	14: 31,240,413	R145Q	possibly damaging	Het
Pitx3	T	C	19: 46,137,424	D20G	possibly damaging	Het
Plxnb1	T	C	9: 109,108,168	V1139A	probably benign	Het
Pon2	A	T	6: 5,268,995	N226K	probably damaging	Het
Ppp1r10	T	A	17: 35,930,133	H642Q	possibly damaging	Het
Prom2	A	G	2: 127,539,811	L195P	probably damaging	Het
Psg23	C	T	7: 18,611,983		probably null	Het
Rfx4	C	A	10: 84,896,012	Q618K	probably benign	Het
Rhobtb1	T	A	10: 69,248,824	I15N	probably damaging	Het
Rhot2	A	T	17: 25,841,609	V233E	probably damaging	Het
Ripply2	T	C	9: 87,019,756	S112P	possibly damaging	Het
Slc12a1	C	A	2: 125,214,132	T861N	probably benign	Het
Slc35f1	T	A	10: 53,089,414	S308R	probably damaging	Het
Slc35f4	T	A	14: 49,298,898	I427F	probably damaging	Het
Sned1	G	A	1: 93,289,358	V1322I	probably benign	Het
Sprr2f	G	A	3: 92,365,944	V17M	unknown	Het
Srd5a3	A	G	5: 76,154,643	H285R	probably benign	Het
Stab1	T	C	14: 31,159,259	T605A	probably benign	Het
Syne1	T	C	10: 5,273,718	Q3054R	probably damaging	Het
Tas1r1	T	C	4: 152,038,308	T27A	probably benign	Het
Tmem150b	A	T	7: 4,716,210	V237E	probably benign	Het
Trpv6	C	T	6: 41,625,153	M407I	probably benign	Het
Ttn	T	G	2: 76,720,354	D31528A	probably damaging	Het
Uroc1	A	T	6: 90,346,362	D354V	possibly damaging	Het
Vmn2r69	T	C	7: 85,411,259	I372M	probably benign	Het
Vmn2r93	A	T	17: 18,326,410	H848L	probably benign	Het
Zfp971	T	A	2: 178,033,174	C189S	probably damaging	Het

Other mutations in Aspm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Aspm	APN	1	139478691	missense	probably damaging	1.00
IGL00594:Aspm	APN	1	139487422	splice site	probably benign
IGL00808:Aspm	APN	1	139461476	missense	probably benign	0.03
IGL00897:Aspm	APN	1	139477407	missense	probably damaging	0.98
IGL01024:Aspm	APN	1	139478124	missense	possibly damaging	0.66
IGL01410:Aspm	APN	1	139482444	missense	probably benign	0.25
IGL01588:Aspm	APN	1	139478162	missense	probably benign	0.11
IGL01610:Aspm	APN	1	139489670	nonsense	probably null
IGL01633:Aspm	APN	1	139480836	missense	possibly damaging	0.93
IGL01982:Aspm	APN	1	139491588	missense	probably benign	0.12
IGL02429:Aspm	APN	1	139479810	missense	probably benign	0.27
IGL02468:Aspm	APN	1	139480950	missense	probably damaging	1.00
IGL02519:Aspm	APN	1	139461927	splice site	probably benign
IGL02526:Aspm	APN	1	139489719	missense	probably benign	0.03
IGL02716:Aspm	APN	1	139479687	missense	probably damaging	1.00
IGL02876:Aspm	APN	1	139473653	missense	probably damaging	1.00
IGL02953:Aspm	APN	1	139457419	missense	probably benign	0.01
IGL03275:Aspm	APN	1	139487295	missense	probably damaging	1.00
Stemware	UTSW	1	139477459	nonsense	probably null
3-1:Aspm	UTSW	1	139457541	missense	probably benign
R0016:Aspm	UTSW	1	139479544	missense	probably benign	0.01
R0016:Aspm	UTSW	1	139479544	missense	probably benign	0.01
R0106:Aspm	UTSW	1	139476876	missense	probably benign	0.02
R0106:Aspm	UTSW	1	139476876	missense	probably benign	0.02
R0140:Aspm	UTSW	1	139480641	missense	probably benign	0.00
R0195:Aspm	UTSW	1	139479135	missense	probably damaging	1.00
R0217:Aspm	UTSW	1	139457880	missense	possibly damaging	0.46
R0276:Aspm	UTSW	1	139478471	missense	possibly damaging	0.95
R0309:Aspm	UTSW	1	139482511	splice site	probably benign
R0466:Aspm	UTSW	1	139477901	missense	probably damaging	1.00
R0520:Aspm	UTSW	1	139478820	missense	possibly damaging	0.51
R0615:Aspm	UTSW	1	139487289	missense	probably damaging	1.00
R0626:Aspm	UTSW	1	139491601	missense	probably damaging	1.00
R0660:Aspm	UTSW	1	139457764	missense	probably benign	0.03
R0751:Aspm	UTSW	1	139456898	splice site	probably benign
R0830:Aspm	UTSW	1	139474254	missense	probably damaging	0.99
R1109:Aspm	UTSW	1	139456758	missense	probably damaging	0.99
R1114:Aspm	UTSW	1	139461924	splice site	probably benign
R1130:Aspm	UTSW	1	139477834	missense	possibly damaging	0.90
R1298:Aspm	UTSW	1	139457419	missense	probably benign	0.01
R1386:Aspm	UTSW	1	139457623	missense	probably benign	0.03
R1386:Aspm	UTSW	1	139478972	missense	possibly damaging	0.80
R1557:Aspm	UTSW	1	139468668	missense	probably benign	0.01
R1625:Aspm	UTSW	1	139481039	missense	probably benign	0.01
R1728:Aspm	UTSW	1	139473574	missense	probably benign
R1729:Aspm	UTSW	1	139473574	missense	probably benign
R1730:Aspm	UTSW	1	139473574	missense	probably benign
R1733:Aspm	UTSW	1	139457117	missense	probably benign	0.27
R1739:Aspm	UTSW	1	139473574	missense	probably benign
R1762:Aspm	UTSW	1	139473574	missense	probably benign
R1783:Aspm	UTSW	1	139473574	missense	probably benign
R1784:Aspm	UTSW	1	139473574	missense	probably benign
R1785:Aspm	UTSW	1	139473574	missense	probably benign
R1793:Aspm	UTSW	1	139457341	missense	probably benign	0.00
R1893:Aspm	UTSW	1	139479867	missense	probably damaging	1.00
R1911:Aspm	UTSW	1	139478094	missense	probably benign	0.06
R2103:Aspm	UTSW	1	139491665	missense	probably damaging	0.99
R2128:Aspm	UTSW	1	139457635	missense	probably benign	0.14
R2129:Aspm	UTSW	1	139457635	missense	probably benign	0.14
R2239:Aspm	UTSW	1	139456846	missense	possibly damaging	0.67
R2352:Aspm	UTSW	1	139457562	missense	probably benign	0.02
R2353:Aspm	UTSW	1	139477697	missense	probably damaging	1.00
R2380:Aspm	UTSW	1	139479348	missense	probably damaging	1.00
R2413:Aspm	UTSW	1	139477757	missense	probably damaging	1.00
R2421:Aspm	UTSW	1	139488487	missense	possibly damaging	0.49
R3607:Aspm	UTSW	1	139480668	missense	probably benign	0.13
R3711:Aspm	UTSW	1	139458100	missense	probably benign	0.17
R3718:Aspm	UTSW	1	139480889	missense	probably benign	0.09
R3718:Aspm	UTSW	1	139490427	missense	probably benign	0.31
R3741:Aspm	UTSW	1	139478619	missense	possibly damaging	0.47
R3788:Aspm	UTSW	1	139463203	missense	probably damaging	1.00
R3838:Aspm	UTSW	1	139478054	missense	probably benign	0.24
R3839:Aspm	UTSW	1	139478054	missense	probably benign	0.24
R3849:Aspm	UTSW	1	139458286	missense	probably benign	0.21
R4075:Aspm	UTSW	1	139474285	missense	probably damaging	1.00
R4080:Aspm	UTSW	1	139470755	missense	probably damaging	1.00
R4463:Aspm	UTSW	1	139455010	missense	possibly damaging	0.95
R4537:Aspm	UTSW	1	139474303	missense	probably benign	0.01
R4547:Aspm	UTSW	1	139478187	missense	possibly damaging	0.75
R4573:Aspm	UTSW	1	139479507	missense	probably damaging	0.98
R4680:Aspm	UTSW	1	139480671	missense	probably benign	0.05
R4807:Aspm	UTSW	1	139477919	missense	probably damaging	1.00
R4840:Aspm	UTSW	1	139470531	missense	possibly damaging	0.83
R4854:Aspm	UTSW	1	139478072	nonsense	probably null
R4859:Aspm	UTSW	1	139469393	missense	probably damaging	1.00
R4893:Aspm	UTSW	1	139489839	critical splice donor site	probably null
R4910:Aspm	UTSW	1	139491543	missense	probably damaging	1.00
R4953:Aspm	UTSW	1	139471734	missense	probably benign	0.00
R4974:Aspm	UTSW	1	139478010	missense	probably benign	0.03
R4981:Aspm	UTSW	1	139470760	splice site	probably null
R5082:Aspm	UTSW	1	139478676	nonsense	probably null
R5223:Aspm	UTSW	1	139478334	missense	probably damaging	1.00
R5268:Aspm	UTSW	1	139464295	missense	probably damaging	1.00
R5371:Aspm	UTSW	1	139470541	nonsense	probably null
R5377:Aspm	UTSW	1	139457483	missense	probably damaging	0.96
R5377:Aspm	UTSW	1	139470395	splice site	probably null
R5481:Aspm	UTSW	1	139457061	missense	possibly damaging	0.85
R5513:Aspm	UTSW	1	139482398	missense	probably damaging	1.00
R5578:Aspm	UTSW	1	139470717	missense	probably damaging	1.00
R5649:Aspm	UTSW	1	139479669	missense	probably benign
R5685:Aspm	UTSW	1	139487288	missense	probably benign	0.10
R5695:Aspm	UTSW	1	139479669	missense	probably benign
R5766:Aspm	UTSW	1	139479002	missense	probably damaging	0.99
R5964:Aspm	UTSW	1	139455227	intron	probably benign
R5993:Aspm	UTSW	1	139479531	missense	probably benign	0.28
R6027:Aspm	UTSW	1	139463056	missense	probably damaging	1.00
R6029:Aspm	UTSW	1	139480990	missense	possibly damaging	0.83
R6102:Aspm	UTSW	1	139477459	nonsense	probably null
R6188:Aspm	UTSW	1	139479239	missense	possibly damaging	0.79
R6257:Aspm	UTSW	1	139482053	splice site	probably null
R6433:Aspm	UTSW	1	139473683	missense	probably damaging	1.00
R6682:Aspm	UTSW	1	139457722	missense	possibly damaging	0.67
R6763:Aspm	UTSW	1	139470517	missense	possibly damaging	0.64
R6798:Aspm	UTSW	1	139468685	missense	possibly damaging	0.66
R6815:Aspm	UTSW	1	139480142	missense	probably benign	0.04
R6854:Aspm	UTSW	1	139463182	missense	possibly damaging	0.90
R6928:Aspm	UTSW	1	139480206	nonsense	probably null
R6943:Aspm	UTSW	1	139480542	missense	probably damaging	1.00
R6979:Aspm	UTSW	1	139480485	missense	probably damaging	1.00
R6998:Aspm	UTSW	1	139469472	missense	probably damaging	1.00
R7126:Aspm	UTSW	1	139480803	missense	probably benign	0.27
R7237:Aspm	UTSW	1	139477929	missense	possibly damaging	0.81
R7240:Aspm	UTSW	1	139478651	nonsense	probably null
R7272:Aspm	UTSW	1	139458328	missense	probably benign	0.14
R7519:Aspm	UTSW	1	139490336	missense	possibly damaging	0.53
R7776:Aspm	UTSW	1	139479846	missense	possibly damaging	0.85
R7875:Aspm	UTSW	1	139455134	missense	probably benign	0.02
R7883:Aspm	UTSW	1	139478667	missense	possibly damaging	0.47
R7964:Aspm	UTSW	1	139480686	missense	probably damaging	1.00
R8012:Aspm	UTSW	1	139457464	missense	probably benign	0.03
R8029:Aspm	UTSW	1	139471632	missense	probably benign	0.00
R8233:Aspm	UTSW	1	139457304	missense	probably benign	0.28
R8277:Aspm	UTSW	1	139455010	missense	probably damaging	1.00
R8345:Aspm	UTSW	1	139464273	nonsense	probably null
R8491:Aspm	UTSW	1	139457695	missense	probably damaging	0.98
R8511:Aspm	UTSW	1	139457308	missense	probably damaging	1.00
R8557:Aspm	UTSW	1	139456756	missense	probably benign	0.01
R8927:Aspm	UTSW	1	139490387	nonsense	probably null
R8928:Aspm	UTSW	1	139490387	nonsense	probably null
R8950:Aspm	UTSW	1	139478952	missense	probably damaging	1.00
R9033:Aspm	UTSW	1	139478127	missense	probably damaging	1.00
R9083:Aspm	UTSW	1	139493698	missense	possibly damaging	0.70
R9133:Aspm	UTSW	1	139491528	missense	probably damaging	1.00
R9160:Aspm	UTSW	1	139490124	missense	probably damaging	1.00
R9179:Aspm	UTSW	1	139476715	missense	probably damaging	1.00
R9265:Aspm	UTSW	1	139461444	missense	probably benign	0.24
R9400:Aspm	UTSW	1	139479903	missense	probably damaging	1.00
R9419:Aspm	UTSW	1	139457185	missense	probably benign	0.29
R9454:Aspm	UTSW	1	139480994	missense	probably benign	0.00
R9517:Aspm	UTSW	1	139479429	missense	probably damaging	1.00
R9524:Aspm	UTSW	1	139480869	missense	probably damaging	1.00
R9544:Aspm	UTSW	1	139457785	missense	probably benign	0.01
R9640:Aspm	UTSW	1	139480272	missense	possibly damaging	0.88
R9698:Aspm	UTSW	1	139461908	missense	probably benign	0.28
R9790:Aspm	UTSW	1	139480637	missense	probably damaging	0.98
R9791:Aspm	UTSW	1	139480637	missense	probably damaging	0.98
R9794:Aspm	UTSW	1	139478742	missense	probably damaging	0.99
X0063:Aspm	UTSW	1	139458090	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TAGGAAACTCACGCTTGCCC -3'
(R):5'- GTCTGTGCATGCTGACACTC -3'

Sequencing Primer
(F):5'- CCAAACTGTTCTTCACCTTTGAATAG -3'
(R):5'- GAGAAGCTTCATTTGACTTACCCG -3'

Posted On

2019-10-07