Incidental Mutation 'R7427:Zfp971'
ID 576156
Institutional Source Beutler Lab
Gene Symbol Zfp971
Ensembl Gene ENSMUSG00000074519
Gene Name zinc finger protein 971
Synonyms Etohi1
MMRRC Submission 045505-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R7427 (G1)
Quality Score 218.009
Status Validated
Chromosome 2
Chromosomal Location 177665077-177675815 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 177674967 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 189 (C189S)
Ref Sequence ENSEMBL: ENSMUSP00000104554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108925] [ENSMUST00000108926]
AlphaFold A2BFG8
Predicted Effect probably benign
Transcript: ENSMUST00000108925
SMART Domains Protein: ENSMUSP00000104553
Gene: ENSMUSG00000074519

DomainStartEndE-ValueType
KRAB 4 64 1.2e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108926
AA Change: C189S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104554
Gene: ENSMUSG00000074519
AA Change: C189S

DomainStartEndE-ValueType
KRAB 4 66 1.6e-13 SMART
ZnF_C2H2 78 97 1.38e2 SMART
ZnF_C2H2 103 125 4.38e1 SMART
ZnF_C2H2 131 153 1.92e-2 SMART
ZnF_C2H2 159 181 4.79e-3 SMART
ZnF_C2H2 187 209 2.36e-2 SMART
ZnF_C2H2 215 237 2.36e-2 SMART
ZnF_C2H2 243 265 3.69e-4 SMART
ZnF_C2H2 271 293 4.87e-4 SMART
ZnF_C2H2 299 321 4.4e-2 SMART
ZnF_C2H2 327 349 4.61e-5 SMART
ZnF_C2H2 355 377 4.94e-5 SMART
ZnF_C2H2 383 405 3.21e-4 SMART
ZnF_C2H2 411 433 4.47e-3 SMART
ZnF_C2H2 439 461 5.99e-4 SMART
Meta Mutation Damage Score 0.8853 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (78/78)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck5 T A 15: 76,478,585 (GRCm39) C318S possibly damaging Het
Aspm T A 1: 139,385,354 (GRCm39) C333S probably benign Het
B3gnt4 A G 5: 123,648,794 (GRCm39) N53S probably damaging Het
Bpifb5 G A 2: 154,067,042 (GRCm39) M98I probably benign Het
Cacna2d3 A G 14: 28,786,232 (GRCm39) M585T probably damaging Het
Cbarp T C 10: 79,967,138 (GRCm39) D701G probably damaging Het
Ccn2 T G 10: 24,473,397 (GRCm39) M312R probably damaging Het
Cntrl T A 2: 35,060,546 (GRCm39) W1913R probably benign Het
Cry2 T C 2: 92,243,392 (GRCm39) D483G possibly damaging Het
Csmd1 A G 8: 16,073,864 (GRCm39) F2044L possibly damaging Het
Cxcl16 A G 11: 70,349,630 (GRCm39) V78A possibly damaging Het
Cxcr6 A T 9: 123,639,305 (GRCm39) Y109F probably benign Het
Cyb5b A G 8: 107,897,048 (GRCm39) D106G probably benign Het
D630036H23Rik T C 12: 36,431,537 (GRCm39) R154G unknown Het
Dnah9 T C 11: 65,846,045 (GRCm39) T2998A probably benign Het
Focad T C 4: 88,286,988 (GRCm39) S1254P unknown Het
Gm21886 A T 18: 80,132,867 (GRCm39) L97Q probably damaging Het
Gpr158 A C 2: 21,832,129 (GRCm39) L1076F probably benign Het
Hivep2 T C 10: 14,009,485 (GRCm39) M1714T possibly damaging Het
Hlcs A G 16: 94,068,758 (GRCm39) V154A probably benign Het
Hpdl A T 4: 116,678,062 (GRCm39) L133Q probably damaging Het
Il1rn C A 2: 24,239,554 (GRCm39) T150K probably benign Het
Il6st A G 13: 112,625,094 (GRCm39) I237V probably benign Het
Inpp5f A G 7: 128,281,529 (GRCm39) D510G probably damaging Het
Ism2 G T 12: 87,333,769 (GRCm39) T92K possibly damaging Het
Kif13b T C 14: 65,025,909 (GRCm39) I1422T probably benign Het
Kit G A 5: 75,806,507 (GRCm39) V671I possibly damaging Het
Klhdc8a A T 1: 132,230,705 (GRCm39) N190I probably damaging Het
Lad1 C T 1: 135,753,576 (GRCm39) T41I probably damaging Het
Lrrc7 G T 3: 157,903,778 (GRCm39) T294K probably benign Het
Megf8 C T 7: 25,037,796 (GRCm39) R771C probably benign Het
Micu3 A C 8: 40,831,955 (GRCm39) N440T possibly damaging Het
Mnx1 T C 5: 29,679,211 (GRCm39) N291D unknown Het
Mthfr A G 4: 148,136,060 (GRCm39) M378V probably benign Het
Mup2 A T 4: 60,138,454 (GRCm39) D79E probably benign Het
Myzap T C 9: 71,412,465 (GRCm39) T451A probably benign Het
Nlrp9c T C 7: 26,070,860 (GRCm39) D907G probably benign Het
Nr1h4 T C 10: 89,334,267 (GRCm39) E41G probably benign Het
Nup98 A T 7: 101,784,208 (GRCm39) probably null Het
Nxpe5 A C 5: 138,238,022 (GRCm39) Y194S probably damaging Het
Omd A T 13: 49,745,745 (GRCm39) E385V possibly damaging Het
Or12d15 T C 17: 37,694,190 (GRCm39) V244A probably damaging Het
Or12e9 G T 2: 87,202,034 (GRCm39) V53L probably benign Het
Or2av9 A G 11: 58,380,606 (GRCm39) I325T probably benign Het
Or52m1 A G 7: 102,289,533 (GRCm39) I27V probably benign Het
Or5m12 T A 2: 85,734,475 (GRCm39) R308* probably null Het
Or5m3 A T 2: 85,838,563 (GRCm39) I148L probably benign Het
Or9s18 A G 13: 65,300,866 (GRCm39) Y276C probably damaging Het
Pcdh9 G T 14: 94,124,547 (GRCm39) T541K probably damaging Het
Pdia6 T C 12: 17,328,546 (GRCm39) V167A probably damaging Het
Phf7 C T 14: 30,962,370 (GRCm39) R145Q possibly damaging Het
Pitx3 T C 19: 46,125,863 (GRCm39) D20G possibly damaging Het
Plxnb1 T C 9: 108,937,236 (GRCm39) V1139A probably benign Het
Pon2 A T 6: 5,268,995 (GRCm39) N226K probably damaging Het
Potegl C T 2: 23,147,006 (GRCm39) R337C probably benign Het
Ppp1r10 T A 17: 36,241,025 (GRCm39) H642Q possibly damaging Het
Prom2 A G 2: 127,381,731 (GRCm39) L195P probably damaging Het
Psg23 C T 7: 18,345,908 (GRCm39) probably null Het
Rfx4 C A 10: 84,731,876 (GRCm39) Q618K probably benign Het
Rhobtb1 T A 10: 69,084,654 (GRCm39) I15N probably damaging Het
Rhot2 A T 17: 26,060,583 (GRCm39) V233E probably damaging Het
Ripply2 T C 9: 86,901,809 (GRCm39) S112P possibly damaging Het
Slc12a1 C A 2: 125,056,052 (GRCm39) T861N probably benign Het
Slc35f1 T A 10: 52,965,510 (GRCm39) S308R probably damaging Het
Slc35f4 T A 14: 49,536,355 (GRCm39) I427F probably damaging Het
Slco1a8 T G 6: 141,949,234 (GRCm39) probably null Het
Sned1 G A 1: 93,217,080 (GRCm39) V1322I probably benign Het
Sprr2f G A 3: 92,273,251 (GRCm39) V17M unknown Het
Srd5a3 A G 5: 76,302,490 (GRCm39) H285R probably benign Het
Stab1 T C 14: 30,881,216 (GRCm39) T605A probably benign Het
Syne1 T C 10: 5,223,718 (GRCm39) Q3054R probably damaging Het
Tas1r1 T C 4: 152,122,765 (GRCm39) T27A probably benign Het
Tmem150b A T 7: 4,719,209 (GRCm39) V237E probably benign Het
Trpv6 C T 6: 41,602,087 (GRCm39) M407I probably benign Het
Ttn T G 2: 76,550,698 (GRCm39) D31528A probably damaging Het
Uroc1 A T 6: 90,323,344 (GRCm39) D354V possibly damaging Het
Vmn2r69 T C 7: 85,060,467 (GRCm39) I372M probably benign Het
Vmn2r93 A T 17: 18,546,672 (GRCm39) H848L probably benign Het
Other mutations in Zfp971
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Zfp971 APN 2 177,665,175 (GRCm39) critical splice donor site probably null
R1108:Zfp971 UTSW 2 177,675,463 (GRCm39) missense probably damaging 1.00
R1759:Zfp971 UTSW 2 177,675,722 (GRCm39) missense probably damaging 0.99
R2183:Zfp971 UTSW 2 177,675,533 (GRCm39) missense probably damaging 1.00
R2343:Zfp971 UTSW 2 177,674,787 (GRCm39) missense possibly damaging 0.84
R4873:Zfp971 UTSW 2 177,674,940 (GRCm39) missense probably benign 0.24
R4875:Zfp971 UTSW 2 177,674,940 (GRCm39) missense probably benign 0.24
R5263:Zfp971 UTSW 2 177,675,555 (GRCm39) missense probably damaging 1.00
R5396:Zfp971 UTSW 2 177,675,526 (GRCm39) missense probably damaging 1.00
R6150:Zfp971 UTSW 2 177,675,247 (GRCm39) missense probably benign 0.26
R6693:Zfp971 UTSW 2 177,675,224 (GRCm39) missense probably benign 0.01
R6811:Zfp971 UTSW 2 177,675,674 (GRCm39) missense possibly damaging 0.62
R7428:Zfp971 UTSW 2 177,674,967 (GRCm39) missense probably damaging 1.00
R7594:Zfp971 UTSW 2 177,675,793 (GRCm39) missense possibly damaging 0.47
R7790:Zfp971 UTSW 2 177,675,292 (GRCm39) missense probably damaging 0.96
R7796:Zfp971 UTSW 2 177,673,403 (GRCm39) missense probably benign 0.00
R7934:Zfp971 UTSW 2 177,675,173 (GRCm39) missense probably benign
R7990:Zfp971 UTSW 2 177,675,361 (GRCm39) missense probably damaging 1.00
R8671:Zfp971 UTSW 2 177,675,730 (GRCm39) missense probably damaging 1.00
R9181:Zfp971 UTSW 2 177,674,736 (GRCm39) missense probably damaging 1.00
R9575:Zfp971 UTSW 2 177,675,303 (GRCm39) missense probably damaging 0.99
R9629:Zfp971 UTSW 2 177,675,417 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCCAATTGTATTTGCAGGCA -3'
(R):5'- AGTTTTCCCCTTCTTACAAAAGC -3'

Sequencing Primer
(F):5'- GAAGTTCTTCTGCAGAGCAAC -3'
(R):5'- CCCCTTCTTACAAAAGCTTTATCAC -3'
Posted On 2019-10-07