Incidental Mutation 'R7427:Lrrc7'
ID576158
Institutional Source Beutler Lab
Gene Symbol Lrrc7
Ensembl Gene ENSMUSG00000028176
Gene Nameleucine rich repeat containing 7
Synonymsdensin
MMRRC Submission
Accession Numbers

Genbank: NM_001081358; MGI: 2676665

Is this an essential gene? Possibly essential (E-score: 0.666) question?
Stock #R7427 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location158082891-158562221 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 158198141 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 294 (T294K)
Ref Sequence ENSEMBL: ENSMUSP00000142498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106044] [ENSMUST00000199890] [ENSMUST00000200137]
Predicted Effect probably benign
Transcript: ENSMUST00000106044
AA Change: T294K

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000101659
Gene: ENSMUSG00000028176
AA Change: T294K

DomainStartEndE-ValueType
LRR 53 73 3.65e0 SMART
LRR 96 118 2.2e1 SMART
LRR 142 164 4.21e1 SMART
LRR 165 187 7.36e0 SMART
LRR 188 210 7.05e-1 SMART
LRR 211 233 3.09e1 SMART
LRR 234 257 4.21e1 SMART
LRR 258 279 2.61e2 SMART
LRR 280 303 3.52e-1 SMART
LRR 326 349 1.99e0 SMART
LRR 372 394 2.63e0 SMART
low complexity region 466 476 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
Blast:PDZ 708 736 1e-5 BLAST
low complexity region 787 797 N/A INTRINSIC
low complexity region 864 878 N/A INTRINSIC
Blast:PDZ 1349 1378 2e-11 BLAST
PDZ 1460 1540 1.33e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000199890
AA Change: T294K

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142440
Gene: ENSMUSG00000028176
AA Change: T294K

DomainStartEndE-ValueType
LRR 53 73 3.65e0 SMART
LRR 96 118 2.2e1 SMART
LRR 142 164 4.21e1 SMART
LRR 165 187 7.36e0 SMART
LRR 188 210 7.05e-1 SMART
LRR 211 233 3.09e1 SMART
LRR 234 257 4.21e1 SMART
LRR 258 279 2.61e2 SMART
LRR 280 303 3.52e-1 SMART
LRR 326 349 1.99e0 SMART
LRR 372 394 2.63e0 SMART
low complexity region 466 476 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
Blast:PDZ 708 736 9e-6 BLAST
low complexity region 787 797 N/A INTRINSIC
low complexity region 864 878 N/A INTRINSIC
Blast:PDZ 1328 1364 1e-15 BLAST
low complexity region 1374 1387 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200137
AA Change: T294K

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000142498
Gene: ENSMUSG00000028176
AA Change: T294K

DomainStartEndE-ValueType
LRR 52 69 7.6e-1 SMART
LRR 73 92 4.2e-1 SMART
LRR 96 115 3.4e-1 SMART
LRR 142 164 1.8e-1 SMART
LRR 165 184 1.5e-1 SMART
LRR 188 207 2e-2 SMART
LRR 211 233 1.3e-1 SMART
LRR 234 257 1.7e-1 SMART
LRR 257 276 1e0 SMART
LRR 280 299 3.1e-2 SMART
LRR 303 322 6.6e-1 SMART
LRR 326 345 2.1e-1 SMART
LRR 372 391 1.2e-1 SMART
low complexity region 466 476 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
Blast:PDZ 708 736 1e-5 BLAST
low complexity region 787 797 N/A INTRINSIC
low complexity region 864 878 N/A INTRINSIC
Blast:PDZ 1302 1331 2e-11 BLAST
PDZ 1413 1493 6.4e-22 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (78/78)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit limb grasping, reduced long term depression, increased anxiety, increased aggression towards other mice, impaired spatial memory, decreased prepulse inhibition, decreased nesting building behavior, and abnormal dendritic spines. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik C T 2: 23,256,994 R337C probably benign Het
Adck5 T A 15: 76,594,385 C318S possibly damaging Het
Aspm T A 1: 139,457,616 C333S probably benign Het
B3gnt4 A G 5: 123,510,731 N53S probably damaging Het
Bpifb5 G A 2: 154,225,122 M98I probably benign Het
Cacna2d3 A G 14: 29,064,275 M585T probably damaging Het
Cbarp T C 10: 80,131,304 D701G probably damaging Het
Cntrl T A 2: 35,170,534 W1913R probably benign Het
Cry2 T C 2: 92,413,047 D483G possibly damaging Het
Csmd1 A G 8: 16,023,850 F2044L possibly damaging Het
Ctgf T G 10: 24,597,499 M312R probably damaging Het
Cxcl16 A G 11: 70,458,804 V78A possibly damaging Het
Cxcr6 A T 9: 123,810,240 Y109F probably benign Het
Cyb5b A G 8: 107,170,416 D106G probably benign Het
D630036H23Rik T C 12: 36,381,538 R154G unknown Het
Dnah9 T C 11: 65,955,219 T2998A probably benign Het
Focad T C 4: 88,368,751 S1254P unknown Het
Gm21886 A T 18: 80,089,652 L97Q probably damaging Het
Gm6614 T G 6: 142,003,508 probably null Het
Gpr158 A C 2: 21,827,318 L1076F probably benign Het
Hivep2 T C 10: 14,133,741 M1714T possibly damaging Het
Hlcs A G 16: 94,267,899 V154A probably benign Het
Hpdl A T 4: 116,820,865 L133Q probably damaging Het
Il1rn C A 2: 24,349,542 T150K probably benign Het
Il6st A G 13: 112,488,560 I237V probably benign Het
Inpp5f A G 7: 128,679,805 D510G probably damaging Het
Ism2 G T 12: 87,286,995 T92K possibly damaging Het
Kif13b T C 14: 64,788,460 I1422T probably benign Het
Kit G A 5: 75,645,847 V671I possibly damaging Het
Klhdc8a A T 1: 132,302,967 N190I probably damaging Het
Lad1 C T 1: 135,825,838 T41I probably damaging Het
Megf8 C T 7: 25,338,371 R771C probably benign Het
Micu3 A C 8: 40,378,914 N440T possibly damaging Het
Mnx1 T C 5: 29,474,213 N291D unknown Het
Mthfr A G 4: 148,051,603 M378V probably benign Het
Mup2 A T 4: 60,138,454 D79E probably benign Het
Myzap T C 9: 71,505,183 T451A probably benign Het
Nlrp9c T C 7: 26,371,435 D907G probably benign Het
Nr1h4 T C 10: 89,498,405 E41G probably benign Het
Nup98 A T 7: 102,135,001 probably null Het
Nxpe5 A C 5: 138,239,760 Y194S probably damaging Het
Olfr1024 T A 2: 85,904,131 R308* probably null Het
Olfr1032 A T 2: 86,008,219 I148L probably benign Het
Olfr105-ps T C 17: 37,383,299 V244A probably damaging Het
Olfr1121 G T 2: 87,371,690 V53L probably benign Het
Olfr332 A G 11: 58,489,780 I325T probably benign Het
Olfr466 A G 13: 65,153,052 Y276C probably damaging Het
Olfr554 A G 7: 102,640,326 I27V probably benign Het
Omd A T 13: 49,592,269 E385V possibly damaging Het
Pcdh9 G T 14: 93,887,111 T541K probably damaging Het
Pdia6 T C 12: 17,278,545 V167A probably damaging Het
Phf7 C T 14: 31,240,413 R145Q possibly damaging Het
Pitx3 T C 19: 46,137,424 D20G possibly damaging Het
Plxnb1 T C 9: 109,108,168 V1139A probably benign Het
Pon2 A T 6: 5,268,995 N226K probably damaging Het
Ppp1r10 T A 17: 35,930,133 H642Q possibly damaging Het
Prom2 A G 2: 127,539,811 L195P probably damaging Het
Psg23 C T 7: 18,611,983 probably null Het
Rfx4 C A 10: 84,896,012 Q618K probably benign Het
Rhobtb1 T A 10: 69,248,824 I15N probably damaging Het
Rhot2 A T 17: 25,841,609 V233E probably damaging Het
Ripply2 T C 9: 87,019,756 S112P possibly damaging Het
Slc12a1 C A 2: 125,214,132 T861N probably benign Het
Slc35f1 T A 10: 53,089,414 S308R probably damaging Het
Slc35f4 T A 14: 49,298,898 I427F probably damaging Het
Sned1 G A 1: 93,289,358 V1322I probably benign Het
Sprr2f G A 3: 92,365,944 V17M unknown Het
Srd5a3 A G 5: 76,154,643 H285R probably benign Het
Stab1 T C 14: 31,159,259 T605A probably benign Het
Syne1 T C 10: 5,273,718 Q3054R probably damaging Het
Tas1r1 T C 4: 152,038,308 T27A probably benign Het
Tmem150b A T 7: 4,716,210 V237E probably benign Het
Trpv6 C T 6: 41,625,153 M407I probably benign Het
Ttn T G 2: 76,720,354 D31528A probably damaging Het
Uroc1 A T 6: 90,346,362 D354V possibly damaging Het
Vmn2r69 T C 7: 85,411,259 I372M probably benign Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Zfp971 T A 2: 178,033,174 C189S probably damaging Het
Other mutations in Lrrc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Lrrc7 APN 3 158187010 missense probably benign 0.07
IGL00644:Lrrc7 APN 3 158202368 nonsense probably null
IGL00822:Lrrc7 APN 3 158185474 missense probably damaging 0.99
IGL00927:Lrrc7 APN 3 158161090 missense possibly damaging 0.94
IGL00946:Lrrc7 APN 3 158161356 missense probably benign 0.07
IGL00948:Lrrc7 APN 3 158161557 missense probably damaging 1.00
IGL01838:Lrrc7 APN 3 158185463 missense probably damaging 1.00
IGL01874:Lrrc7 APN 3 158240443 splice site probably benign
IGL02514:Lrrc7 APN 3 158160292 missense probably damaging 0.96
IGL02545:Lrrc7 APN 3 158185374 splice site probably benign
IGL02665:Lrrc7 APN 3 158161105 missense probably damaging 0.99
IGL03129:Lrrc7 APN 3 158161059 missense probably benign 0.02
N/A:Lrrc7 UTSW 3 158160340 missense probably benign
R0021:Lrrc7 UTSW 3 158160661 missense probably damaging 1.00
R0041:Lrrc7 UTSW 3 158164260 splice site probably benign
R0255:Lrrc7 UTSW 3 158160838 nonsense probably null
R0278:Lrrc7 UTSW 3 158179795 missense possibly damaging 0.96
R0409:Lrrc7 UTSW 3 158161426 missense possibly damaging 0.59
R0612:Lrrc7 UTSW 3 158164353 missense probably damaging 0.98
R0866:Lrrc7 UTSW 3 158164266 splice site probably benign
R1077:Lrrc7 UTSW 3 158161143 missense probably damaging 1.00
R1103:Lrrc7 UTSW 3 158148706 splice site probably benign
R1157:Lrrc7 UTSW 3 158160255 missense probably damaging 1.00
R1187:Lrrc7 UTSW 3 158160402 missense probably damaging 1.00
R1301:Lrrc7 UTSW 3 158135331 missense probably benign 0.20
R1433:Lrrc7 UTSW 3 158177306 missense probably damaging 1.00
R1450:Lrrc7 UTSW 3 158187044 missense possibly damaging 0.62
R1595:Lrrc7 UTSW 3 158177277 nonsense probably null
R1659:Lrrc7 UTSW 3 158161408 missense probably damaging 1.00
R1693:Lrrc7 UTSW 3 158084533 missense possibly damaging 0.95
R1774:Lrrc7 UTSW 3 158160292 missense possibly damaging 0.88
R2273:Lrrc7 UTSW 3 158187059 missense probably damaging 1.00
R2276:Lrrc7 UTSW 3 158179792 missense probably damaging 1.00
R2302:Lrrc7 UTSW 3 158135244 missense probably damaging 0.99
R2326:Lrrc7 UTSW 3 158170661 missense probably damaging 1.00
R2371:Lrrc7 UTSW 3 158161060 missense probably damaging 0.99
R2383:Lrrc7 UTSW 3 158163956 missense probably benign
R2679:Lrrc7 UTSW 3 158175108 nonsense probably null
R2698:Lrrc7 UTSW 3 158135391 missense probably benign 0.22
R2858:Lrrc7 UTSW 3 158161725 missense probably damaging 0.99
R3758:Lrrc7 UTSW 3 158163965 missense probably damaging 1.00
R3791:Lrrc7 UTSW 3 158163956 missense probably benign
R3805:Lrrc7 UTSW 3 158185493 missense probably benign 0.10
R3806:Lrrc7 UTSW 3 158185493 missense probably benign 0.10
R3807:Lrrc7 UTSW 3 158185493 missense probably benign 0.10
R3892:Lrrc7 UTSW 3 158160696 missense probably benign 0.08
R3912:Lrrc7 UTSW 3 158291952 missense probably damaging 1.00
R3913:Lrrc7 UTSW 3 158291952 missense probably damaging 1.00
R3963:Lrrc7 UTSW 3 158160405 missense probably damaging 1.00
R4665:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4666:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4671:Lrrc7 UTSW 3 158202495 critical splice acceptor site probably null
R4688:Lrrc7 UTSW 3 158148605 missense probably damaging 1.00
R4725:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4726:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4728:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4783:Lrrc7 UTSW 3 158127213 critical splice donor site probably null
R4867:Lrrc7 UTSW 3 158161005 missense probably damaging 1.00
R4907:Lrrc7 UTSW 3 158161240 missense probably damaging 1.00
R5032:Lrrc7 UTSW 3 158181580 missense possibly damaging 0.85
R5107:Lrrc7 UTSW 3 158161896 missense probably damaging 1.00
R5295:Lrrc7 UTSW 3 158170739 missense probably damaging 1.00
R5348:Lrrc7 UTSW 3 158175326 missense probably benign 0.02
R5468:Lrrc7 UTSW 3 158318436 missense probably damaging 1.00
R5778:Lrrc7 UTSW 3 158170743 missense probably damaging 1.00
R5897:Lrrc7 UTSW 3 158164353 missense probably damaging 0.98
R6179:Lrrc7 UTSW 3 158353432 missense probably damaging 0.99
R6312:Lrrc7 UTSW 3 158160609 missense probably benign 0.04
R6313:Lrrc7 UTSW 3 158160736 missense probably damaging 1.00
R6366:Lrrc7 UTSW 3 158135375 missense probably benign 0.04
R6389:Lrrc7 UTSW 3 158185426 missense probably damaging 1.00
R6638:Lrrc7 UTSW 3 158135303 missense probably benign 0.20
R6956:Lrrc7 UTSW 3 158289031 missense probably benign 0.02
R6969:Lrrc7 UTSW 3 158156913 missense probably benign 0.19
R7073:Lrrc7 UTSW 3 158127247 missense probably damaging 1.00
R7313:Lrrc7 UTSW 3 158160474 missense probably damaging 1.00
R7365:Lrrc7 UTSW 3 158198161 missense probably damaging 1.00
R7398:Lrrc7 UTSW 3 158291958 nonsense probably null
R7403:Lrrc7 UTSW 3 158148674 nonsense probably null
R7407:Lrrc7 UTSW 3 158135241 missense probably damaging 1.00
R7453:Lrrc7 UTSW 3 158185409 missense probably benign 0.00
R7461:Lrrc7 UTSW 3 158187020 missense probably benign 0.00
R7807:Lrrc7 UTSW 3 158160487 missense probably damaging 1.00
R7872:Lrrc7 UTSW 3 158353462 missense probably damaging 0.99
R7955:Lrrc7 UTSW 3 158353462 missense probably damaging 0.99
R8215:Lrrc7 UTSW 3 158209750 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTTGAGAAAGGTTCATGACTGAC -3'
(R):5'- CCAAAGCTAGTCTGTGTTCTATTTG -3'

Sequencing Primer
(F):5'- AGCTGATTCAGTGGTCAG -3'
(R):5'- GTGTGTTGTAATATGAAGAACATGGC -3'
Posted On2019-10-07