Incidental Mutation 'R7427:Gm6614'
ID576172
Institutional Source Beutler Lab
Gene Symbol Gm6614
Ensembl Gene ENSMUSG00000079263
Gene Namepredicted gene 6614
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R7427 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location141971845-142011414 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to G at 142003508 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111832] [ENSMUST00000181628] [ENSMUST00000181791]
Predicted Effect probably null
Transcript: ENSMUST00000111832
SMART Domains Protein: ENSMUSP00000107463
Gene: ENSMUSG00000079263

DomainStartEndE-ValueType
Pfam:OATP 1 577 2.5e-156 PFAM
Pfam:MFS_1 125 402 1e-23 PFAM
Pfam:Kazal_2 425 466 4.1e-9 PFAM
transmembrane domain 580 602 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000181628
SMART Domains Protein: ENSMUSP00000137967
Gene: ENSMUSG00000079263

DomainStartEndE-ValueType
Pfam:OATP 19 598 2.8e-187 PFAM
Pfam:MFS_1 145 422 8e-24 PFAM
Pfam:Kazal_2 445 486 1.1e-7 PFAM
transmembrane domain 600 622 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000181791
SMART Domains Protein: ENSMUSP00000137696
Gene: ENSMUSG00000079263

DomainStartEndE-ValueType
Pfam:OATP 1 578 2.3e-186 PFAM
Pfam:MFS_1 125 402 8.6e-24 PFAM
Pfam:Kazal_2 425 466 1.4e-7 PFAM
transmembrane domain 580 602 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik C T 2: 23,256,994 R337C probably benign Het
Adck5 T A 15: 76,594,385 C318S possibly damaging Het
Aspm T A 1: 139,457,616 C333S probably benign Het
B3gnt4 A G 5: 123,510,731 N53S probably damaging Het
Bpifb5 G A 2: 154,225,122 M98I probably benign Het
Cacna2d3 A G 14: 29,064,275 M585T probably damaging Het
Cbarp T C 10: 80,131,304 D701G probably damaging Het
Cntrl T A 2: 35,170,534 W1913R probably benign Het
Cry2 T C 2: 92,413,047 D483G possibly damaging Het
Csmd1 A G 8: 16,023,850 F2044L possibly damaging Het
Ctgf T G 10: 24,597,499 M312R probably damaging Het
Cxcl16 A G 11: 70,458,804 V78A possibly damaging Het
Cxcr6 A T 9: 123,810,240 Y109F probably benign Het
Cyb5b A G 8: 107,170,416 D106G probably benign Het
D630036H23Rik T C 12: 36,381,538 R154G unknown Het
Dnah9 T C 11: 65,955,219 T2998A probably benign Het
Focad T C 4: 88,368,751 S1254P unknown Het
Gm21886 A T 18: 80,089,652 L97Q probably damaging Het
Gpr158 A C 2: 21,827,318 L1076F probably benign Het
Hivep2 T C 10: 14,133,741 M1714T possibly damaging Het
Hlcs A G 16: 94,267,899 V154A probably benign Het
Hpdl A T 4: 116,820,865 L133Q probably damaging Het
Il1rn C A 2: 24,349,542 T150K probably benign Het
Il6st A G 13: 112,488,560 I237V probably benign Het
Inpp5f A G 7: 128,679,805 D510G probably damaging Het
Ism2 G T 12: 87,286,995 T92K possibly damaging Het
Kif13b T C 14: 64,788,460 I1422T probably benign Het
Kit G A 5: 75,645,847 V671I possibly damaging Het
Klhdc8a A T 1: 132,302,967 N190I probably damaging Het
Lad1 C T 1: 135,825,838 T41I probably damaging Het
Lrrc7 G T 3: 158,198,141 T294K probably benign Het
Megf8 C T 7: 25,338,371 R771C probably benign Het
Micu3 A C 8: 40,378,914 N440T possibly damaging Het
Mnx1 T C 5: 29,474,213 N291D unknown Het
Mthfr A G 4: 148,051,603 M378V probably benign Het
Mup2 A T 4: 60,138,454 D79E probably benign Het
Myzap T C 9: 71,505,183 T451A probably benign Het
Nlrp9c T C 7: 26,371,435 D907G probably benign Het
Nr1h4 T C 10: 89,498,405 E41G probably benign Het
Nxpe5 A C 5: 138,239,760 Y194S probably damaging Het
Olfr1024 T A 2: 85,904,131 R308* probably null Het
Olfr1032 A T 2: 86,008,219 I148L probably benign Het
Olfr105-ps T C 17: 37,383,299 V244A probably damaging Het
Olfr1121 G T 2: 87,371,690 V53L probably benign Het
Olfr332 A G 11: 58,489,780 I325T probably benign Het
Olfr466 A G 13: 65,153,052 Y276C probably damaging Het
Olfr554 A G 7: 102,640,326 I27V probably benign Het
Omd A T 13: 49,592,269 E385V possibly damaging Het
Pcdh9 G T 14: 93,887,111 T541K probably damaging Het
Pdia6 T C 12: 17,278,545 V167A probably damaging Het
Phf7 C T 14: 31,240,413 R145Q possibly damaging Het
Pitx3 T C 19: 46,137,424 D20G possibly damaging Het
Plxnb1 T C 9: 109,108,168 V1139A probably benign Het
Pon2 A T 6: 5,268,995 N226K probably damaging Het
Ppp1r10 T A 17: 35,930,133 H642Q possibly damaging Het
Prom2 A G 2: 127,539,811 L195P probably damaging Het
Rfx4 C A 10: 84,896,012 Q618K probably benign Het
Rhobtb1 T A 10: 69,248,824 I15N probably damaging Het
Rhot2 A T 17: 25,841,609 V233E probably damaging Het
Ripply2 T C 9: 87,019,756 S112P possibly damaging Het
Slc12a1 C A 2: 125,214,132 T861N probably benign Het
Slc35f1 T A 10: 53,089,414 S308R probably damaging Het
Slc35f4 T A 14: 49,298,898 I427F probably damaging Het
Sned1 G A 1: 93,289,358 V1322I probably benign Het
Sprr2f G A 3: 92,365,944 V17M unknown Het
Srd5a3 A G 5: 76,154,643 H285R probably benign Het
Stab1 T C 14: 31,159,259 T605A probably benign Het
Syne1 T C 10: 5,273,718 Q3054R probably damaging Het
Tas1r1 T C 4: 152,038,308 T27A probably benign Het
Tmem150b A T 7: 4,716,210 V237E probably benign Het
Trpv6 C T 6: 41,625,153 M407I probably benign Het
Ttn T G 2: 76,720,354 D31528A probably damaging Het
Uroc1 A T 6: 90,346,362 D354V possibly damaging Het
Vmn2r69 T C 7: 85,411,259 I372M probably benign Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Zfp971 T A 2: 178,033,174 C189S probably damaging Het
Other mutations in Gm6614
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01354:Gm6614 APN 6 141990408 missense probably benign 0.00
IGL01548:Gm6614 APN 6 141992512 missense possibly damaging 0.82
IGL01552:Gm6614 APN 6 141987706 missense possibly damaging 0.54
IGL02207:Gm6614 APN 6 141990432 missense possibly damaging 0.80
IGL02227:Gm6614 APN 6 141993675 nonsense probably null
IGL02547:Gm6614 APN 6 141990390 missense probably damaging 0.99
IGL02678:Gm6614 APN 6 142008718 missense probably damaging 1.00
IGL02695:Gm6614 APN 6 141987760 missense probably damaging 1.00
IGL02851:Gm6614 APN 6 142003471 missense probably damaging 1.00
IGL02881:Gm6614 APN 6 141972243 missense probably benign 0.00
IGL02898:Gm6614 APN 6 141994297 missense probably benign 0.01
IGL03036:Gm6614 APN 6 142008607 missense possibly damaging 0.69
IGL03065:Gm6614 APN 6 141992502 missense probably damaging 0.99
IGL03300:Gm6614 APN 6 141994806 missense probably damaging 0.96
R0020:Gm6614 UTSW 6 141972350 missense possibly damaging 0.93
R0020:Gm6614 UTSW 6 141972350 missense possibly damaging 0.93
R0049:Gm6614 UTSW 6 141990421 missense probably benign
R0049:Gm6614 UTSW 6 141990421 missense probably benign
R0149:Gm6614 UTSW 6 141992477 missense probably benign 0.01
R0270:Gm6614 UTSW 6 141972411 missense possibly damaging 0.88
R0360:Gm6614 UTSW 6 141982327 splice site probably benign
R0420:Gm6614 UTSW 6 141985477 splice site probably benign
R0737:Gm6614 UTSW 6 142003428 missense possibly damaging 0.79
R1344:Gm6614 UTSW 6 141985618 missense probably damaging 1.00
R1464:Gm6614 UTSW 6 141992517 nonsense probably null
R1464:Gm6614 UTSW 6 141992517 nonsense probably null
R1590:Gm6614 UTSW 6 141980872 missense probably benign 0.00
R1666:Gm6614 UTSW 6 141982049 splice site probably null
R1669:Gm6614 UTSW 6 141987689 missense probably benign 0.39
R1862:Gm6614 UTSW 6 142003423 missense possibly damaging 0.95
R1882:Gm6614 UTSW 6 141993637 critical splice donor site probably null
R2134:Gm6614 UTSW 6 141980978 missense probably damaging 1.00
R2155:Gm6614 UTSW 6 141980944 missense probably damaging 1.00
R2163:Gm6614 UTSW 6 141980938 missense possibly damaging 0.55
R2227:Gm6614 UTSW 6 141992361 missense possibly damaging 0.67
R2382:Gm6614 UTSW 6 141990480 missense probably benign 0.00
R3773:Gm6614 UTSW 6 141972335 missense probably benign 0.17
R4869:Gm6614 UTSW 6 141987766 missense probably damaging 1.00
R4975:Gm6614 UTSW 6 141980873 missense probably benign 0.30
R5061:Gm6614 UTSW 6 142008688 missense probably benign 0.03
R5079:Gm6614 UTSW 6 141972347 missense probably benign 0.00
R5312:Gm6614 UTSW 6 141972332 missense probably benign 0.00
R5691:Gm6614 UTSW 6 141994855 nonsense probably null
R5874:Gm6614 UTSW 6 141972235 missense probably benign 0.00
R5945:Gm6614 UTSW 6 141994282 missense probably damaging 1.00
R6478:Gm6614 UTSW 6 141993642 missense possibly damaging 0.93
R7305:Gm6614 UTSW 6 141992494 missense probably damaging 1.00
R7325:Gm6614 UTSW 6 141989225 missense probably damaging 0.98
R7728:Gm6614 UTSW 6 141987710 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTTTCCTCCTCCCAGAAAG -3'
(R):5'- AGAGCTTTAGTATTCTCCAGAGAG -3'

Sequencing Primer
(F):5'- TTTCCTCCTCCCAGAAAGGAAATTC -3'
(R):5'- GATCCTTCCCTCAGAATCACAATTG -3'
Posted On2019-10-07