Incidental Mutation 'R7427:Vmn2r69'
ID576176
Institutional Source Beutler Lab
Gene Symbol Vmn2r69
Ensembl Gene ENSMUSG00000091006
Gene Namevomeronasal 2, receptor 69
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R7427 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location85404849-85417476 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85411259 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 372 (I372M)
Ref Sequence ENSEMBL: ENSMUSP00000132726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171213]
Predicted Effect probably benign
Transcript: ENSMUST00000171213
AA Change: I372M

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000132726
Gene: ENSMUSG00000091006
AA Change: I372M

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 465 1.3e-28 PFAM
Pfam:NCD3G 507 559 1.8e-20 PFAM
Pfam:7tm_3 592 827 3.2e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (78/78)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik C T 2: 23,256,994 R337C probably benign Het
Adck5 T A 15: 76,594,385 C318S possibly damaging Het
Aspm T A 1: 139,457,616 C333S probably benign Het
B3gnt4 A G 5: 123,510,731 N53S probably damaging Het
Bpifb5 G A 2: 154,225,122 M98I probably benign Het
Cacna2d3 A G 14: 29,064,275 M585T probably damaging Het
Cbarp T C 10: 80,131,304 D701G probably damaging Het
Cntrl T A 2: 35,170,534 W1913R probably benign Het
Cry2 T C 2: 92,413,047 D483G possibly damaging Het
Csmd1 A G 8: 16,023,850 F2044L possibly damaging Het
Ctgf T G 10: 24,597,499 M312R probably damaging Het
Cxcl16 A G 11: 70,458,804 V78A possibly damaging Het
Cxcr6 A T 9: 123,810,240 Y109F probably benign Het
Cyb5b A G 8: 107,170,416 D106G probably benign Het
D630036H23Rik T C 12: 36,381,538 R154G unknown Het
Dnah9 T C 11: 65,955,219 T2998A probably benign Het
Focad T C 4: 88,368,751 S1254P unknown Het
Gm21886 A T 18: 80,089,652 L97Q probably damaging Het
Gm6614 T G 6: 142,003,508 probably null Het
Gpr158 A C 2: 21,827,318 L1076F probably benign Het
Hivep2 T C 10: 14,133,741 M1714T possibly damaging Het
Hlcs A G 16: 94,267,899 V154A probably benign Het
Hpdl A T 4: 116,820,865 L133Q probably damaging Het
Il1rn C A 2: 24,349,542 T150K probably benign Het
Il6st A G 13: 112,488,560 I237V probably benign Het
Inpp5f A G 7: 128,679,805 D510G probably damaging Het
Ism2 G T 12: 87,286,995 T92K possibly damaging Het
Kif13b T C 14: 64,788,460 I1422T probably benign Het
Kit G A 5: 75,645,847 V671I possibly damaging Het
Klhdc8a A T 1: 132,302,967 N190I probably damaging Het
Lad1 C T 1: 135,825,838 T41I probably damaging Het
Lrrc7 G T 3: 158,198,141 T294K probably benign Het
Megf8 C T 7: 25,338,371 R771C probably benign Het
Micu3 A C 8: 40,378,914 N440T possibly damaging Het
Mnx1 T C 5: 29,474,213 N291D unknown Het
Mthfr A G 4: 148,051,603 M378V probably benign Het
Mup2 A T 4: 60,138,454 D79E probably benign Het
Myzap T C 9: 71,505,183 T451A probably benign Het
Nlrp9c T C 7: 26,371,435 D907G probably benign Het
Nr1h4 T C 10: 89,498,405 E41G probably benign Het
Nup98 A T 7: 102,135,001 probably null Het
Nxpe5 A C 5: 138,239,760 Y194S probably damaging Het
Olfr1024 T A 2: 85,904,131 R308* probably null Het
Olfr1032 A T 2: 86,008,219 I148L probably benign Het
Olfr105-ps T C 17: 37,383,299 V244A probably damaging Het
Olfr1121 G T 2: 87,371,690 V53L probably benign Het
Olfr332 A G 11: 58,489,780 I325T probably benign Het
Olfr466 A G 13: 65,153,052 Y276C probably damaging Het
Olfr554 A G 7: 102,640,326 I27V probably benign Het
Omd A T 13: 49,592,269 E385V possibly damaging Het
Pcdh9 G T 14: 93,887,111 T541K probably damaging Het
Pdia6 T C 12: 17,278,545 V167A probably damaging Het
Phf7 C T 14: 31,240,413 R145Q possibly damaging Het
Pitx3 T C 19: 46,137,424 D20G possibly damaging Het
Plxnb1 T C 9: 109,108,168 V1139A probably benign Het
Pon2 A T 6: 5,268,995 N226K probably damaging Het
Ppp1r10 T A 17: 35,930,133 H642Q possibly damaging Het
Prom2 A G 2: 127,539,811 L195P probably damaging Het
Psg23 C T 7: 18,611,983 probably null Het
Rfx4 C A 10: 84,896,012 Q618K probably benign Het
Rhobtb1 T A 10: 69,248,824 I15N probably damaging Het
Rhot2 A T 17: 25,841,609 V233E probably damaging Het
Ripply2 T C 9: 87,019,756 S112P possibly damaging Het
Slc12a1 C A 2: 125,214,132 T861N probably benign Het
Slc35f1 T A 10: 53,089,414 S308R probably damaging Het
Slc35f4 T A 14: 49,298,898 I427F probably damaging Het
Sned1 G A 1: 93,289,358 V1322I probably benign Het
Sprr2f G A 3: 92,365,944 V17M unknown Het
Srd5a3 A G 5: 76,154,643 H285R probably benign Het
Stab1 T C 14: 31,159,259 T605A probably benign Het
Syne1 T C 10: 5,273,718 Q3054R probably damaging Het
Tas1r1 T C 4: 152,038,308 T27A probably benign Het
Tmem150b A T 7: 4,716,210 V237E probably benign Het
Trpv6 C T 6: 41,625,153 M407I probably benign Het
Ttn T G 2: 76,720,354 D31528A probably damaging Het
Uroc1 A T 6: 90,346,362 D354V possibly damaging Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Zfp971 T A 2: 178,033,174 C189S probably damaging Het
Other mutations in Vmn2r69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Vmn2r69 APN 7 85406531 missense probably benign
IGL01457:Vmn2r69 APN 7 85406628 missense possibly damaging 0.87
IGL01760:Vmn2r69 APN 7 85406864 missense possibly damaging 0.90
IGL01834:Vmn2r69 APN 7 85412368 missense probably damaging 1.00
IGL02001:Vmn2r69 APN 7 85407226 missense probably benign 0.05
IGL02057:Vmn2r69 APN 7 85411782 missense possibly damaging 0.93
IGL02289:Vmn2r69 APN 7 85406846 missense probably damaging 1.00
IGL02472:Vmn2r69 APN 7 85409752 missense probably benign 0.01
IGL02478:Vmn2r69 APN 7 85406681 missense probably damaging 1.00
IGL02554:Vmn2r69 APN 7 85409806 missense probably damaging 1.00
IGL02723:Vmn2r69 APN 7 85410208 missense probably damaging 1.00
R0526:Vmn2r69 UTSW 7 85411503 missense probably damaging 1.00
R0560:Vmn2r69 UTSW 7 85409714 critical splice donor site probably null
R0909:Vmn2r69 UTSW 7 85406665 missense probably benign 0.00
R0976:Vmn2r69 UTSW 7 85406900 missense probably damaging 1.00
R1158:Vmn2r69 UTSW 7 85409850 splice site probably benign
R1459:Vmn2r69 UTSW 7 85406700 nonsense probably null
R1482:Vmn2r69 UTSW 7 85406874 missense probably damaging 1.00
R1917:Vmn2r69 UTSW 7 85411683 missense probably damaging 1.00
R2016:Vmn2r69 UTSW 7 85407285 missense probably damaging 0.98
R2108:Vmn2r69 UTSW 7 85410196 missense probably benign
R2571:Vmn2r69 UTSW 7 85415556 missense probably benign
R2910:Vmn2r69 UTSW 7 85406710 missense probably damaging 1.00
R2920:Vmn2r69 UTSW 7 85411765 missense probably benign 0.08
R3708:Vmn2r69 UTSW 7 85411821 missense probably damaging 0.98
R3710:Vmn2r69 UTSW 7 85406393 missense probably benign
R4757:Vmn2r69 UTSW 7 85412367 missense probably damaging 0.99
R4823:Vmn2r69 UTSW 7 85411300 missense probably benign 0.21
R4870:Vmn2r69 UTSW 7 85411585 missense possibly damaging 0.93
R4918:Vmn2r69 UTSW 7 85406759 missense probably benign 0.06
R5022:Vmn2r69 UTSW 7 85411159 missense possibly damaging 0.72
R5174:Vmn2r69 UTSW 7 85415531 missense possibly damaging 0.92
R5200:Vmn2r69 UTSW 7 85406509 missense probably damaging 1.00
R5278:Vmn2r69 UTSW 7 85411783 missense probably benign 0.02
R5643:Vmn2r69 UTSW 7 85407196 missense probably damaging 0.98
R5996:Vmn2r69 UTSW 7 85411909 splice site probably null
R6083:Vmn2r69 UTSW 7 85406503 missense probably damaging 1.00
R6140:Vmn2r69 UTSW 7 85411449 missense probably damaging 0.99
R6306:Vmn2r69 UTSW 7 85415591 missense probably benign 0.04
R6330:Vmn2r69 UTSW 7 85411627 missense probably benign
R6380:Vmn2r69 UTSW 7 85411859 missense probably benign
R6466:Vmn2r69 UTSW 7 85407170 missense probably benign 0.01
R6542:Vmn2r69 UTSW 7 85411205 nonsense probably null
R6583:Vmn2r69 UTSW 7 85409809 missense probably benign
R6623:Vmn2r69 UTSW 7 85407101 missense possibly damaging 0.84
R6709:Vmn2r69 UTSW 7 85411861 missense probably benign 0.03
R6732:Vmn2r69 UTSW 7 85411143 missense probably benign 0.00
R6741:Vmn2r69 UTSW 7 85412516 missense probably benign 0.01
R7070:Vmn2r69 UTSW 7 85411480 missense probably damaging 0.98
R7234:Vmn2r69 UTSW 7 85407107 missense probably benign 0.22
R7323:Vmn2r69 UTSW 7 85411764 missense possibly damaging 0.95
R7428:Vmn2r69 UTSW 7 85411259 missense probably benign 0.28
R7453:Vmn2r69 UTSW 7 85411560 frame shift probably null
R7532:Vmn2r69 UTSW 7 85410414 missense probably benign 0.36
R7556:Vmn2r69 UTSW 7 85411560 frame shift probably null
R7562:Vmn2r69 UTSW 7 85407212 missense probably benign
R7592:Vmn2r69 UTSW 7 85411560 frame shift probably null
R7708:Vmn2r69 UTSW 7 85412547 missense possibly damaging 0.87
R7803:Vmn2r69 UTSW 7 85407116 missense probably benign 0.00
R8071:Vmn2r69 UTSW 7 85406505 nonsense probably null
R8237:Vmn2r69 UTSW 7 85411132 missense probably benign 0.02
Z1176:Vmn2r69 UTSW 7 85406488 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACCTTCCAAGAGTCAAATTCCAG -3'
(R):5'- TAAGAATCTGGGTTAGTGTGTCAC -3'

Sequencing Primer
(F):5'- AGAGTCAAATTCCAGTTCCTTCCCAG -3'
(R):5'- GATCACAATTCTAGGAGATTTCTTGC -3'
Posted On2019-10-07