Incidental Mutation 'R7427:Myzap'
ID576182
Institutional Source Beutler Lab
Gene Symbol Myzap
Ensembl Gene ENSMUSG00000041361
Gene Namemyocardial zonula adherens protein
SynonymsMyozap, Grinl1a7, Gcom1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R7427 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location71504347-71592360 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71505183 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 451 (T451A)
Ref Sequence ENSEMBL: ENSMUSP00000091342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093823] [ENSMUST00000163998] [ENSMUST00000164962] [ENSMUST00000165936] [ENSMUST00000166843] [ENSMUST00000169573]
Predicted Effect probably benign
Transcript: ENSMUST00000093823
AA Change: T451A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000091342
Gene: ENSMUSG00000041361
AA Change: T451A

DomainStartEndE-ValueType
Pfam:GCOM2 96 416 1.1e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163998
SMART Domains Protein: ENSMUSP00000131267
Gene: ENSMUSG00000092137

DomainStartEndE-ValueType
coiled coil region 105 138 N/A INTRINSIC
coiled coil region 187 415 N/A INTRINSIC
coiled coil region 483 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164962
SMART Domains Protein: ENSMUSP00000131353
Gene: ENSMUSG00000092137

DomainStartEndE-ValueType
Pfam:GCOM2 96 390 7.5e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165936
SMART Domains Protein: ENSMUSP00000127356
Gene: ENSMUSG00000092137

DomainStartEndE-ValueType
Pfam:GCOM2 96 379 4.2e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166843
SMART Domains Protein: ENSMUSP00000128698
Gene: ENSMUSG00000092137

DomainStartEndE-ValueType
Pfam:GCOM2 96 416 4.6e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169573
AA Change: T423A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000127028
Gene: ENSMUSG00000041361
AA Change: T423A

DomainStartEndE-ValueType
Pfam:GCOM2 96 388 6.6e-68 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is abundantly expressed in cardiac tissue. The encoded protein localizes to intercalated discs in cardiomyocytes and functions as an activator of Rho-dependent serum-response factor signaling. Alternative splicing results in multiple transcript variants. Readthrough transcription also exists between this gene and the neighboring downstream gene POLR2M (polymerase (RNA) II (DNA directed) polypeptide M) and is represented with GeneID: 145781. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous KO results in a maladaptive response to increased biomechanical stress, resulting in adverse cardiac remodeling, contractile dysfunction, heart failure, and increased mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik C T 2: 23,256,994 R337C probably benign Het
Adck5 T A 15: 76,594,385 C318S possibly damaging Het
Aspm T A 1: 139,457,616 C333S probably benign Het
B3gnt4 A G 5: 123,510,731 N53S probably damaging Het
Bpifb5 G A 2: 154,225,122 M98I probably benign Het
Cacna2d3 A G 14: 29,064,275 M585T probably damaging Het
Cbarp T C 10: 80,131,304 D701G probably damaging Het
Cntrl T A 2: 35,170,534 W1913R probably benign Het
Cry2 T C 2: 92,413,047 D483G possibly damaging Het
Csmd1 A G 8: 16,023,850 F2044L possibly damaging Het
Ctgf T G 10: 24,597,499 M312R probably damaging Het
Cxcl16 A G 11: 70,458,804 V78A possibly damaging Het
Cxcr6 A T 9: 123,810,240 Y109F probably benign Het
Cyb5b A G 8: 107,170,416 D106G probably benign Het
D630036H23Rik T C 12: 36,381,538 R154G unknown Het
Dnah9 T C 11: 65,955,219 T2998A probably benign Het
Focad T C 4: 88,368,751 S1254P unknown Het
Gm21886 A T 18: 80,089,652 L97Q probably damaging Het
Gm6614 T G 6: 142,003,508 probably null Het
Gpr158 A C 2: 21,827,318 L1076F probably benign Het
Hivep2 T C 10: 14,133,741 M1714T possibly damaging Het
Hlcs A G 16: 94,267,899 V154A probably benign Het
Hpdl A T 4: 116,820,865 L133Q probably damaging Het
Il1rn C A 2: 24,349,542 T150K probably benign Het
Il6st A G 13: 112,488,560 I237V probably benign Het
Inpp5f A G 7: 128,679,805 D510G probably damaging Het
Ism2 G T 12: 87,286,995 T92K possibly damaging Het
Kif13b T C 14: 64,788,460 I1422T probably benign Het
Kit G A 5: 75,645,847 V671I possibly damaging Het
Klhdc8a A T 1: 132,302,967 N190I probably damaging Het
Lad1 C T 1: 135,825,838 T41I probably damaging Het
Lrrc7 G T 3: 158,198,141 T294K probably benign Het
Megf8 C T 7: 25,338,371 R771C probably benign Het
Micu3 A C 8: 40,378,914 N440T possibly damaging Het
Mnx1 T C 5: 29,474,213 N291D unknown Het
Mthfr A G 4: 148,051,603 M378V probably benign Het
Mup2 A T 4: 60,138,454 D79E probably benign Het
Nlrp9c T C 7: 26,371,435 D907G probably benign Het
Nr1h4 T C 10: 89,498,405 E41G probably benign Het
Nup98 A T 7: 102,135,001 probably null Het
Nxpe5 A C 5: 138,239,760 Y194S probably damaging Het
Olfr1024 T A 2: 85,904,131 R308* probably null Het
Olfr1032 A T 2: 86,008,219 I148L probably benign Het
Olfr105-ps T C 17: 37,383,299 V244A probably damaging Het
Olfr1121 G T 2: 87,371,690 V53L probably benign Het
Olfr332 A G 11: 58,489,780 I325T probably benign Het
Olfr466 A G 13: 65,153,052 Y276C probably damaging Het
Olfr554 A G 7: 102,640,326 I27V probably benign Het
Omd A T 13: 49,592,269 E385V possibly damaging Het
Pcdh9 G T 14: 93,887,111 T541K probably damaging Het
Pdia6 T C 12: 17,278,545 V167A probably damaging Het
Phf7 C T 14: 31,240,413 R145Q possibly damaging Het
Pitx3 T C 19: 46,137,424 D20G possibly damaging Het
Plxnb1 T C 9: 109,108,168 V1139A probably benign Het
Pon2 A T 6: 5,268,995 N226K probably damaging Het
Ppp1r10 T A 17: 35,930,133 H642Q possibly damaging Het
Prom2 A G 2: 127,539,811 L195P probably damaging Het
Psg23 C T 7: 18,611,983 probably null Het
Rfx4 C A 10: 84,896,012 Q618K probably benign Het
Rhobtb1 T A 10: 69,248,824 I15N probably damaging Het
Rhot2 A T 17: 25,841,609 V233E probably damaging Het
Ripply2 T C 9: 87,019,756 S112P possibly damaging Het
Slc12a1 C A 2: 125,214,132 T861N probably benign Het
Slc35f1 T A 10: 53,089,414 S308R probably damaging Het
Slc35f4 T A 14: 49,298,898 I427F probably damaging Het
Sned1 G A 1: 93,289,358 V1322I probably benign Het
Sprr2f G A 3: 92,365,944 V17M unknown Het
Srd5a3 A G 5: 76,154,643 H285R probably benign Het
Stab1 T C 14: 31,159,259 T605A probably benign Het
Syne1 T C 10: 5,273,718 Q3054R probably damaging Het
Tas1r1 T C 4: 152,038,308 T27A probably benign Het
Tmem150b A T 7: 4,716,210 V237E probably benign Het
Trpv6 C T 6: 41,625,153 M407I probably benign Het
Ttn T G 2: 76,720,354 D31528A probably damaging Het
Uroc1 A T 6: 90,346,362 D354V possibly damaging Het
Vmn2r69 T C 7: 85,411,259 I372M probably benign Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Zfp971 T A 2: 178,033,174 C189S probably damaging Het
Other mutations in Myzap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Myzap APN 9 71555671 missense probably benign 0.06
IGL01077:Myzap APN 9 71546760 missense probably damaging 1.00
IGL01478:Myzap APN 9 71515067 critical splice donor site probably null
IGL02146:Myzap APN 9 71564448 missense probably benign 0.43
IGL02715:Myzap APN 9 71515115 nonsense probably null
IGL03218:Myzap APN 9 71555589 missense probably benign 0.40
R0674:Myzap UTSW 9 71515144 missense probably damaging 1.00
R2298:Myzap UTSW 9 71548757 missense probably damaging 0.98
R4463:Myzap UTSW 9 71555651 missense probably benign 0.00
R4470:Myzap UTSW 9 71592281 unclassified probably benign
R4548:Myzap UTSW 9 71550246 missense possibly damaging 0.67
R4841:Myzap UTSW 9 71548755 missense probably damaging 1.00
R4842:Myzap UTSW 9 71548755 missense probably damaging 1.00
R6284:Myzap UTSW 9 71558925 missense probably benign 0.21
R6307:Myzap UTSW 9 71558864 missense possibly damaging 0.92
R7489:Myzap UTSW 9 71561038 missense probably benign 0.09
X0018:Myzap UTSW 9 71550295 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TGAAATATGACCTCAGGTACCAG -3'
(R):5'- GTAGTGTTTCTGTGAAATAGGCAAC -3'

Sequencing Primer
(F):5'- TCGATTGCCTGAGATTCCTATTCAAG -3'
(R):5'- GGCAACTGCATAATTAATCACCC -3'
Posted On2019-10-07