Incidental Mutation 'R7427:Cxcl16'
ID576196
Institutional Source Beutler Lab
Gene Symbol Cxcl16
Ensembl Gene ENSMUSG00000018920
Gene Namechemokine (C-X-C motif) ligand 16
SynonymsSR-PSOX, Scavenger Receptor, SR-PSOX/CXCL16, 0910001K24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R7427 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location70453983-70459984 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70458804 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 78 (V78A)
Ref Sequence ENSEMBL: ENSMUSP00000019064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019064] [ENSMUST00000039093] [ENSMUST00000092958] [ENSMUST00000108563] [ENSMUST00000126105] [ENSMUST00000126391] [ENSMUST00000147289]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019064
AA Change: V78A

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000019064
Gene: ENSMUSG00000018920
AA Change: V78A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:SCY 32 94 1e-17 BLAST
transmembrane domain 201 223 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039093
SMART Domains Protein: ENSMUSP00000048816
Gene: ENSMUSG00000040829

DomainStartEndE-ValueType
low complexity region 71 85 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 164 186 N/A INTRINSIC
Pfam:zf-MYND 307 353 6.7e-12 PFAM
low complexity region 438 452 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 702 736 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092958
SMART Domains Protein: ENSMUSP00000090635
Gene: ENSMUSG00000040829

DomainStartEndE-ValueType
low complexity region 71 85 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 164 186 N/A INTRINSIC
Pfam:zf-MYND 306 352 6.5e-11 PFAM
low complexity region 437 451 N/A INTRINSIC
low complexity region 483 495 N/A INTRINSIC
low complexity region 662 696 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108563
SMART Domains Protein: ENSMUSP00000104203
Gene: ENSMUSG00000040829

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
Pfam:zf-MYND 177 223 2.5e-11 PFAM
low complexity region 308 322 N/A INTRINSIC
low complexity region 393 405 N/A INTRINSIC
low complexity region 572 606 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126105
SMART Domains Protein: ENSMUSP00000134599
Gene: ENSMUSG00000040829

DomainStartEndE-ValueType
low complexity region 71 85 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000126391
AA Change: V65A

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133513
Gene: ENSMUSG00000018920
AA Change: V65A

DomainStartEndE-ValueType
Blast:SCY 19 81 3e-18 BLAST
transmembrane domain 188 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147289
SMART Domains Protein: ENSMUSP00000136813
Gene: ENSMUSG00000040829

DomainStartEndE-ValueType
low complexity region 40 54 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (78/78)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased NK T cells, decreased secretion and serum levels of IL4 and IFN-gamma, and decreased inhibition of B16 melanoma cell growth by alpha-galactosylceramide treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik C T 2: 23,256,994 R337C probably benign Het
Adck5 T A 15: 76,594,385 C318S possibly damaging Het
Aspm T A 1: 139,457,616 C333S probably benign Het
B3gnt4 A G 5: 123,510,731 N53S probably damaging Het
Bpifb5 G A 2: 154,225,122 M98I probably benign Het
Cacna2d3 A G 14: 29,064,275 M585T probably damaging Het
Cbarp T C 10: 80,131,304 D701G probably damaging Het
Cntrl T A 2: 35,170,534 W1913R probably benign Het
Cry2 T C 2: 92,413,047 D483G possibly damaging Het
Csmd1 A G 8: 16,023,850 F2044L possibly damaging Het
Ctgf T G 10: 24,597,499 M312R probably damaging Het
Cxcr6 A T 9: 123,810,240 Y109F probably benign Het
Cyb5b A G 8: 107,170,416 D106G probably benign Het
D630036H23Rik T C 12: 36,381,538 R154G unknown Het
Dnah9 T C 11: 65,955,219 T2998A probably benign Het
Focad T C 4: 88,368,751 S1254P unknown Het
Gm21886 A T 18: 80,089,652 L97Q probably damaging Het
Gm6614 T G 6: 142,003,508 probably null Het
Gpr158 A C 2: 21,827,318 L1076F probably benign Het
Hivep2 T C 10: 14,133,741 M1714T possibly damaging Het
Hlcs A G 16: 94,267,899 V154A probably benign Het
Hpdl A T 4: 116,820,865 L133Q probably damaging Het
Il1rn C A 2: 24,349,542 T150K probably benign Het
Il6st A G 13: 112,488,560 I237V probably benign Het
Inpp5f A G 7: 128,679,805 D510G probably damaging Het
Ism2 G T 12: 87,286,995 T92K possibly damaging Het
Kif13b T C 14: 64,788,460 I1422T probably benign Het
Kit G A 5: 75,645,847 V671I possibly damaging Het
Klhdc8a A T 1: 132,302,967 N190I probably damaging Het
Lad1 C T 1: 135,825,838 T41I probably damaging Het
Lrrc7 G T 3: 158,198,141 T294K probably benign Het
Megf8 C T 7: 25,338,371 R771C probably benign Het
Micu3 A C 8: 40,378,914 N440T possibly damaging Het
Mnx1 T C 5: 29,474,213 N291D unknown Het
Mthfr A G 4: 148,051,603 M378V probably benign Het
Mup2 A T 4: 60,138,454 D79E probably benign Het
Myzap T C 9: 71,505,183 T451A probably benign Het
Nlrp9c T C 7: 26,371,435 D907G probably benign Het
Nr1h4 T C 10: 89,498,405 E41G probably benign Het
Nup98 A T 7: 102,135,001 probably null Het
Nxpe5 A C 5: 138,239,760 Y194S probably damaging Het
Olfr1024 T A 2: 85,904,131 R308* probably null Het
Olfr1032 A T 2: 86,008,219 I148L probably benign Het
Olfr105-ps T C 17: 37,383,299 V244A probably damaging Het
Olfr1121 G T 2: 87,371,690 V53L probably benign Het
Olfr332 A G 11: 58,489,780 I325T probably benign Het
Olfr466 A G 13: 65,153,052 Y276C probably damaging Het
Olfr554 A G 7: 102,640,326 I27V probably benign Het
Omd A T 13: 49,592,269 E385V possibly damaging Het
Pcdh9 G T 14: 93,887,111 T541K probably damaging Het
Pdia6 T C 12: 17,278,545 V167A probably damaging Het
Phf7 C T 14: 31,240,413 R145Q possibly damaging Het
Pitx3 T C 19: 46,137,424 D20G possibly damaging Het
Plxnb1 T C 9: 109,108,168 V1139A probably benign Het
Pon2 A T 6: 5,268,995 N226K probably damaging Het
Ppp1r10 T A 17: 35,930,133 H642Q possibly damaging Het
Prom2 A G 2: 127,539,811 L195P probably damaging Het
Psg23 C T 7: 18,611,983 probably null Het
Rfx4 C A 10: 84,896,012 Q618K probably benign Het
Rhobtb1 T A 10: 69,248,824 I15N probably damaging Het
Rhot2 A T 17: 25,841,609 V233E probably damaging Het
Ripply2 T C 9: 87,019,756 S112P possibly damaging Het
Slc12a1 C A 2: 125,214,132 T861N probably benign Het
Slc35f1 T A 10: 53,089,414 S308R probably damaging Het
Slc35f4 T A 14: 49,298,898 I427F probably damaging Het
Sned1 G A 1: 93,289,358 V1322I probably benign Het
Sprr2f G A 3: 92,365,944 V17M unknown Het
Srd5a3 A G 5: 76,154,643 H285R probably benign Het
Stab1 T C 14: 31,159,259 T605A probably benign Het
Syne1 T C 10: 5,273,718 Q3054R probably damaging Het
Tas1r1 T C 4: 152,038,308 T27A probably benign Het
Tmem150b A T 7: 4,716,210 V237E probably benign Het
Trpv6 C T 6: 41,625,153 M407I probably benign Het
Ttn T G 2: 76,720,354 D31528A probably damaging Het
Uroc1 A T 6: 90,346,362 D354V possibly damaging Het
Vmn2r69 T C 7: 85,411,259 I372M probably benign Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Zfp971 T A 2: 178,033,174 C189S probably damaging Het
Other mutations in Cxcl16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02211:Cxcl16 APN 11 70456032 missense possibly damaging 0.65
IGL02867:Cxcl16 APN 11 70459066 missense possibly damaging 0.62
PIT4472001:Cxcl16 UTSW 11 70458799 missense probably damaging 1.00
R0133:Cxcl16 UTSW 11 70458770 missense possibly damaging 0.94
R0415:Cxcl16 UTSW 11 70458748 nonsense probably null
R0732:Cxcl16 UTSW 11 70455408 missense probably damaging 1.00
R0759:Cxcl16 UTSW 11 70459128 missense probably damaging 0.97
R4359:Cxcl16 UTSW 11 70458805 missense possibly damaging 0.81
R4609:Cxcl16 UTSW 11 70455429 missense probably damaging 1.00
R4903:Cxcl16 UTSW 11 70455693 missense probably benign 0.22
R4964:Cxcl16 UTSW 11 70455693 missense probably benign 0.22
R5724:Cxcl16 UTSW 11 70459164 missense probably damaging 0.99
Z1088:Cxcl16 UTSW 11 70455978 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGCCAAATCCAGGAAGATG -3'
(R):5'- AAGTCCCGGAGCCTAATTCC -3'

Sequencing Primer
(F):5'- ATGATATTGGGAAAACACAGACTG -3'
(R):5'- CCGGAGCCTAATTCCTTTCTAG -3'
Posted On2019-10-07