Incidental Mutation 'R7427:Pdia6'
ID576197
Institutional Source Beutler Lab
Gene Symbol Pdia6
Ensembl Gene ENSMUSG00000020571
Gene Nameprotein disulfide isomerase associated 6
SynonymsTxndc7, CaBP5, P5, 1700015E05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7427 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location17266545-17284770 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17278545 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 167 (V167A)
Ref Sequence ENSEMBL: ENSMUSP00000052912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057288]
Predicted Effect probably damaging
Transcript: ENSMUST00000057288
AA Change: V167A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000052912
Gene: ENSMUSG00000020571
AA Change: V167A

DomainStartEndE-ValueType
Pfam:Thioredoxin 31 134 5.6e-32 PFAM
low complexity region 143 159 N/A INTRINSIC
Pfam:Thioredoxin 166 272 7.4e-33 PFAM
low complexity region 427 445 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162936
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163000
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, two catalytically active thioredoxin (TRX) domains, a TRX-like domain, and a C-terminal ER-retention sequence. This protein inhibits the aggregation of misfolded proteins and exhibits both isomerase and chaperone activity. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik C T 2: 23,256,994 R337C probably benign Het
Adck5 T A 15: 76,594,385 C318S possibly damaging Het
Aspm T A 1: 139,457,616 C333S probably benign Het
B3gnt4 A G 5: 123,510,731 N53S probably damaging Het
Bpifb5 G A 2: 154,225,122 M98I probably benign Het
Cacna2d3 A G 14: 29,064,275 M585T probably damaging Het
Cbarp T C 10: 80,131,304 D701G probably damaging Het
Cntrl T A 2: 35,170,534 W1913R probably benign Het
Cry2 T C 2: 92,413,047 D483G possibly damaging Het
Csmd1 A G 8: 16,023,850 F2044L possibly damaging Het
Ctgf T G 10: 24,597,499 M312R probably damaging Het
Cxcl16 A G 11: 70,458,804 V78A possibly damaging Het
Cxcr6 A T 9: 123,810,240 Y109F probably benign Het
Cyb5b A G 8: 107,170,416 D106G probably benign Het
D630036H23Rik T C 12: 36,381,538 R154G unknown Het
Dnah9 T C 11: 65,955,219 T2998A probably benign Het
Focad T C 4: 88,368,751 S1254P unknown Het
Gm21886 A T 18: 80,089,652 L97Q probably damaging Het
Gm6614 T G 6: 142,003,508 probably null Het
Gpr158 A C 2: 21,827,318 L1076F probably benign Het
Hivep2 T C 10: 14,133,741 M1714T possibly damaging Het
Hlcs A G 16: 94,267,899 V154A probably benign Het
Hpdl A T 4: 116,820,865 L133Q probably damaging Het
Il1rn C A 2: 24,349,542 T150K probably benign Het
Il6st A G 13: 112,488,560 I237V probably benign Het
Inpp5f A G 7: 128,679,805 D510G probably damaging Het
Ism2 G T 12: 87,286,995 T92K possibly damaging Het
Kif13b T C 14: 64,788,460 I1422T probably benign Het
Kit G A 5: 75,645,847 V671I possibly damaging Het
Klhdc8a A T 1: 132,302,967 N190I probably damaging Het
Lad1 C T 1: 135,825,838 T41I probably damaging Het
Lrrc7 G T 3: 158,198,141 T294K probably benign Het
Megf8 C T 7: 25,338,371 R771C probably benign Het
Micu3 A C 8: 40,378,914 N440T possibly damaging Het
Mnx1 T C 5: 29,474,213 N291D unknown Het
Mthfr A G 4: 148,051,603 M378V probably benign Het
Mup2 A T 4: 60,138,454 D79E probably benign Het
Myzap T C 9: 71,505,183 T451A probably benign Het
Nlrp9c T C 7: 26,371,435 D907G probably benign Het
Nr1h4 T C 10: 89,498,405 E41G probably benign Het
Nup98 A T 7: 102,135,001 probably null Het
Nxpe5 A C 5: 138,239,760 Y194S probably damaging Het
Olfr1024 T A 2: 85,904,131 R308* probably null Het
Olfr1032 A T 2: 86,008,219 I148L probably benign Het
Olfr105-ps T C 17: 37,383,299 V244A probably damaging Het
Olfr1121 G T 2: 87,371,690 V53L probably benign Het
Olfr332 A G 11: 58,489,780 I325T probably benign Het
Olfr466 A G 13: 65,153,052 Y276C probably damaging Het
Olfr554 A G 7: 102,640,326 I27V probably benign Het
Omd A T 13: 49,592,269 E385V possibly damaging Het
Pcdh9 G T 14: 93,887,111 T541K probably damaging Het
Phf7 C T 14: 31,240,413 R145Q possibly damaging Het
Pitx3 T C 19: 46,137,424 D20G possibly damaging Het
Plxnb1 T C 9: 109,108,168 V1139A probably benign Het
Pon2 A T 6: 5,268,995 N226K probably damaging Het
Ppp1r10 T A 17: 35,930,133 H642Q possibly damaging Het
Prom2 A G 2: 127,539,811 L195P probably damaging Het
Psg23 C T 7: 18,611,983 probably null Het
Rfx4 C A 10: 84,896,012 Q618K probably benign Het
Rhobtb1 T A 10: 69,248,824 I15N probably damaging Het
Rhot2 A T 17: 25,841,609 V233E probably damaging Het
Ripply2 T C 9: 87,019,756 S112P possibly damaging Het
Slc12a1 C A 2: 125,214,132 T861N probably benign Het
Slc35f1 T A 10: 53,089,414 S308R probably damaging Het
Slc35f4 T A 14: 49,298,898 I427F probably damaging Het
Sned1 G A 1: 93,289,358 V1322I probably benign Het
Sprr2f G A 3: 92,365,944 V17M unknown Het
Srd5a3 A G 5: 76,154,643 H285R probably benign Het
Stab1 T C 14: 31,159,259 T605A probably benign Het
Syne1 T C 10: 5,273,718 Q3054R probably damaging Het
Tas1r1 T C 4: 152,038,308 T27A probably benign Het
Tmem150b A T 7: 4,716,210 V237E probably benign Het
Trpv6 C T 6: 41,625,153 M407I probably benign Het
Ttn T G 2: 76,720,354 D31528A probably damaging Het
Uroc1 A T 6: 90,346,362 D354V possibly damaging Het
Vmn2r69 T C 7: 85,411,259 I372M probably benign Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Zfp971 T A 2: 178,033,174 C189S probably damaging Het
Other mutations in Pdia6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Pdia6 APN 12 17270541 splice site probably benign
IGL01686:Pdia6 APN 12 17283957 unclassified probably benign
IGL01978:Pdia6 APN 12 17274422 missense possibly damaging 0.82
IGL02044:Pdia6 APN 12 17283226 missense probably damaging 0.98
IGL02630:Pdia6 APN 12 17274421 missense probably benign 0.45
IGL03102:Pdia6 APN 12 17281039 unclassified probably null
braum UTSW 12 17270456 missense probably damaging 1.00
R2126:Pdia6 UTSW 12 17278545 missense probably damaging 1.00
R3037:Pdia6 UTSW 12 17279645 missense probably damaging 1.00
R3768:Pdia6 UTSW 12 17270456 missense probably damaging 1.00
R3769:Pdia6 UTSW 12 17270456 missense probably damaging 1.00
R5639:Pdia6 UTSW 12 17278593 missense probably benign
R6230:Pdia6 UTSW 12 17277213 missense probably benign 0.08
R7305:Pdia6 UTSW 12 17274508 missense probably benign 0.20
R7428:Pdia6 UTSW 12 17278545 missense probably damaging 1.00
R8013:Pdia6 UTSW 12 17273965 missense probably damaging 1.00
R8014:Pdia6 UTSW 12 17273965 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTTCCAGTGCAATCCTGG -3'
(R):5'- TGCACAGCCTAATCCCTGTC -3'

Sequencing Primer
(F):5'- TCCAGTGCAATCCTGGTGAAC -3'
(R):5'- TACACTGTGGTAGCTTCACCAAAGG -3'
Posted On2019-10-07