Incidental Mutation 'R7427:Stab1'
ID 576204
Institutional Source Beutler Lab
Gene Symbol Stab1
Ensembl Gene ENSMUSG00000042286
Gene Name stabilin 1
Synonyms MS-1
MMRRC Submission 045505-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7427 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 31139013-31168641 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 31159259 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 605 (T605A)
Ref Sequence ENSEMBL: ENSMUSP00000046199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036618]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000036618
AA Change: T605A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000046199
Gene: ENSMUSG00000042286
AA Change: T605A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 112 149 6.65e-2 SMART
EGF 160 194 2.28e0 SMART
EGF 199 232 1.4e0 SMART
EGF 236 272 4.97e-1 SMART
EGF 276 319 1.95e1 SMART
EGF_like 321 357 5.03e1 SMART
low complexity region 400 413 N/A INTRINSIC
Blast:FAS1 414 501 2e-52 BLAST
FAS1 543 645 1.35e-24 SMART
EGF_like 780 817 5.45e1 SMART
EGF 822 861 1.08e-1 SMART
EGF 865 904 3.15e-3 SMART
EGF 908 947 1.3e1 SMART
EGF 951 989 1.47e1 SMART
FAS1 1023 1122 1.3e-17 SMART
FAS1 1165 1257 2.94e0 SMART
EGF 1332 1369 1.4e0 SMART
EGF 1379 1413 1.88e-1 SMART
EGF 1420 1455 6.02e0 SMART
EGF 1459 1497 3.82e-2 SMART
EGF 1501 1540 2.05e-2 SMART
EGF 1544 1583 2.25e1 SMART
FAS1 1616 1712 1.61e-22 SMART
FAS1 1763 1868 2.12e-17 SMART
EGF 1970 2007 1.26e-2 SMART
EGF 2017 2051 1.61e0 SMART
EGF 2059 2090 2.45e0 SMART
EGF 2094 2131 3.46e0 SMART
EGF 2135 2174 3.82e-2 SMART
LINK 2206 2301 8.55e-49 SMART
FAS1 2367 2462 2.06e-6 SMART
transmembrane domain 2476 2498 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 16 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to endocytose ligands such as low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein rapidly cycles between the plasma membrane and early endosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no physical or behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik C T 2: 23,256,994 R337C probably benign Het
Adck5 T A 15: 76,594,385 C318S possibly damaging Het
Aspm T A 1: 139,457,616 C333S probably benign Het
B3gnt4 A G 5: 123,510,731 N53S probably damaging Het
Bpifb5 G A 2: 154,225,122 M98I probably benign Het
Cacna2d3 A G 14: 29,064,275 M585T probably damaging Het
Cbarp T C 10: 80,131,304 D701G probably damaging Het
Cntrl T A 2: 35,170,534 W1913R probably benign Het
Cry2 T C 2: 92,413,047 D483G possibly damaging Het
Csmd1 A G 8: 16,023,850 F2044L possibly damaging Het
Ctgf T G 10: 24,597,499 M312R probably damaging Het
Cxcl16 A G 11: 70,458,804 V78A possibly damaging Het
Cxcr6 A T 9: 123,810,240 Y109F probably benign Het
Cyb5b A G 8: 107,170,416 D106G probably benign Het
D630036H23Rik T C 12: 36,381,538 R154G unknown Het
Dnah9 T C 11: 65,955,219 T2998A probably benign Het
Focad T C 4: 88,368,751 S1254P unknown Het
Gm21886 A T 18: 80,089,652 L97Q probably damaging Het
Gm6614 T G 6: 142,003,508 probably null Het
Gpr158 A C 2: 21,827,318 L1076F probably benign Het
Hivep2 T C 10: 14,133,741 M1714T possibly damaging Het
Hlcs A G 16: 94,267,899 V154A probably benign Het
Hpdl A T 4: 116,820,865 L133Q probably damaging Het
Il1rn C A 2: 24,349,542 T150K probably benign Het
Il6st A G 13: 112,488,560 I237V probably benign Het
Inpp5f A G 7: 128,679,805 D510G probably damaging Het
Ism2 G T 12: 87,286,995 T92K possibly damaging Het
Kif13b T C 14: 64,788,460 I1422T probably benign Het
Kit G A 5: 75,645,847 V671I possibly damaging Het
Klhdc8a A T 1: 132,302,967 N190I probably damaging Het
Lad1 C T 1: 135,825,838 T41I probably damaging Het
Lrrc7 G T 3: 158,198,141 T294K probably benign Het
Megf8 C T 7: 25,338,371 R771C probably benign Het
Micu3 A C 8: 40,378,914 N440T possibly damaging Het
Mnx1 T C 5: 29,474,213 N291D unknown Het
Mthfr A G 4: 148,051,603 M378V probably benign Het
Mup2 A T 4: 60,138,454 D79E probably benign Het
Myzap T C 9: 71,505,183 T451A probably benign Het
Nlrp9c T C 7: 26,371,435 D907G probably benign Het
Nr1h4 T C 10: 89,498,405 E41G probably benign Het
Nup98 A T 7: 102,135,001 probably null Het
Nxpe5 A C 5: 138,239,760 Y194S probably damaging Het
Olfr1024 T A 2: 85,904,131 R308* probably null Het
Olfr1032 A T 2: 86,008,219 I148L probably benign Het
Olfr105-ps T C 17: 37,383,299 V244A probably damaging Het
Olfr1121 G T 2: 87,371,690 V53L probably benign Het
Olfr332 A G 11: 58,489,780 I325T probably benign Het
Olfr466 A G 13: 65,153,052 Y276C probably damaging Het
Olfr554 A G 7: 102,640,326 I27V probably benign Het
Omd A T 13: 49,592,269 E385V possibly damaging Het
Pcdh9 G T 14: 93,887,111 T541K probably damaging Het
Pdia6 T C 12: 17,278,545 V167A probably damaging Het
Phf7 C T 14: 31,240,413 R145Q possibly damaging Het
Pitx3 T C 19: 46,137,424 D20G possibly damaging Het
Plxnb1 T C 9: 109,108,168 V1139A probably benign Het
Pon2 A T 6: 5,268,995 N226K probably damaging Het
Ppp1r10 T A 17: 35,930,133 H642Q possibly damaging Het
Prom2 A G 2: 127,539,811 L195P probably damaging Het
Psg23 C T 7: 18,611,983 probably null Het
Rfx4 C A 10: 84,896,012 Q618K probably benign Het
Rhobtb1 T A 10: 69,248,824 I15N probably damaging Het
Rhot2 A T 17: 25,841,609 V233E probably damaging Het
Ripply2 T C 9: 87,019,756 S112P possibly damaging Het
Slc12a1 C A 2: 125,214,132 T861N probably benign Het
Slc35f1 T A 10: 53,089,414 S308R probably damaging Het
Slc35f4 T A 14: 49,298,898 I427F probably damaging Het
Sned1 G A 1: 93,289,358 V1322I probably benign Het
Sprr2f G A 3: 92,365,944 V17M unknown Het
Srd5a3 A G 5: 76,154,643 H285R probably benign Het
Syne1 T C 10: 5,273,718 Q3054R probably damaging Het
Tas1r1 T C 4: 152,038,308 T27A probably benign Het
Tmem150b A T 7: 4,716,210 V237E probably benign Het
Trpv6 C T 6: 41,625,153 M407I probably benign Het
Ttn T G 2: 76,720,354 D31528A probably damaging Het
Uroc1 A T 6: 90,346,362 D354V possibly damaging Het
Vmn2r69 T C 7: 85,411,259 I372M probably benign Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Zfp971 T A 2: 178,033,174 C189S probably damaging Het
Other mutations in Stab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Stab1 APN 14 31161357 missense probably benign 0.01
IGL00323:Stab1 APN 14 31139306 missense probably benign 0.04
IGL00515:Stab1 APN 14 31159729 missense probably benign 0.20
IGL00844:Stab1 APN 14 31147066 missense probably damaging 1.00
IGL01374:Stab1 APN 14 31147075 missense probably damaging 1.00
IGL01384:Stab1 APN 14 31150408 missense probably benign
IGL01431:Stab1 APN 14 31148995 missense probably benign 0.06
IGL01787:Stab1 APN 14 31139808 missense probably damaging 1.00
IGL02128:Stab1 APN 14 31150441 missense probably damaging 1.00
IGL02138:Stab1 APN 14 31143513 critical splice donor site probably null
IGL02256:Stab1 APN 14 31141592 missense probably damaging 1.00
IGL02340:Stab1 APN 14 31140410 missense probably damaging 0.96
IGL02507:Stab1 APN 14 31139210 unclassified probably benign
IGL02695:Stab1 APN 14 31159271 missense probably damaging 1.00
IGL02755:Stab1 APN 14 31139638 missense probably benign 0.01
IGL02870:Stab1 APN 14 31139397 missense probably benign 0.00
IGL02884:Stab1 APN 14 31150143 splice site probably null
IGL03035:Stab1 APN 14 31147769 missense probably benign 0.00
IGL03267:Stab1 APN 14 31142729 missense probably damaging 1.00
IGL03286:Stab1 APN 14 31159326 splice site probably benign
IGL03366:Stab1 APN 14 31150263 missense possibly damaging 0.58
IGL03412:Stab1 APN 14 31154407 missense probably benign 0.42
R0906_Stab1_335 UTSW 14 31145249 missense probably benign 0.19
R5086_Stab1_467 UTSW 14 31159304 missense probably damaging 1.00
IGL02835:Stab1 UTSW 14 31146024 critical splice donor site probably null
K7371:Stab1 UTSW 14 31150249 missense probably damaging 1.00
R0053:Stab1 UTSW 14 31140687 missense possibly damaging 0.57
R0053:Stab1 UTSW 14 31140687 missense possibly damaging 0.57
R0066:Stab1 UTSW 14 31157070 splice site probably benign
R0066:Stab1 UTSW 14 31157070 splice site probably benign
R0363:Stab1 UTSW 14 31159008 splice site probably benign
R0387:Stab1 UTSW 14 31148101 missense probably benign 0.00
R0391:Stab1 UTSW 14 31143418 missense probably benign 0.21
R0513:Stab1 UTSW 14 31148945 missense probably benign 0.08
R0546:Stab1 UTSW 14 31139550 missense possibly damaging 0.92
R0825:Stab1 UTSW 14 31152600 missense probably benign 0.16
R0906:Stab1 UTSW 14 31145249 missense probably benign 0.19
R0963:Stab1 UTSW 14 31147274 missense probably damaging 0.97
R1219:Stab1 UTSW 14 31140621 splice site probably null
R1234:Stab1 UTSW 14 31150236 missense probably damaging 1.00
R1260:Stab1 UTSW 14 31151889 missense probably damaging 1.00
R1400:Stab1 UTSW 14 31139830 missense possibly damaging 0.92
R1405:Stab1 UTSW 14 31149001 missense probably benign 0.19
R1405:Stab1 UTSW 14 31149001 missense probably benign 0.19
R1440:Stab1 UTSW 14 31151690 nonsense probably null
R1472:Stab1 UTSW 14 31141586 missense probably benign 0.01
R1474:Stab1 UTSW 14 31149861 missense probably benign 0.45
R1475:Stab1 UTSW 14 31163828 missense probably benign
R1509:Stab1 UTSW 14 31151584 splice site probably benign
R1551:Stab1 UTSW 14 31160499 missense probably benign 0.00
R1572:Stab1 UTSW 14 31150823 missense probably damaging 1.00
R1633:Stab1 UTSW 14 31150380 splice site probably null
R1719:Stab1 UTSW 14 31146028 nonsense probably null
R1733:Stab1 UTSW 14 31145303 missense probably damaging 1.00
R1763:Stab1 UTSW 14 31168416 missense probably benign 0.04
R1808:Stab1 UTSW 14 31141144 missense possibly damaging 0.80
R1816:Stab1 UTSW 14 31157465 missense probably benign 0.03
R1853:Stab1 UTSW 14 31140463 missense probably damaging 1.00
R1891:Stab1 UTSW 14 31141330 missense probably benign 0.07
R1984:Stab1 UTSW 14 31150648 missense probably benign 0.20
R1998:Stab1 UTSW 14 31162153 nonsense probably null
R2165:Stab1 UTSW 14 31168435 missense probably benign 0.20
R2191:Stab1 UTSW 14 31142800 missense probably benign 0.03
R2191:Stab1 UTSW 14 31159270 missense probably damaging 1.00
R2233:Stab1 UTSW 14 31161880 missense probably benign 0.08
R2303:Stab1 UTSW 14 31146070 missense probably damaging 1.00
R2496:Stab1 UTSW 14 31161463 missense probably damaging 1.00
R2504:Stab1 UTSW 14 31163040 critical splice donor site probably null
R2519:Stab1 UTSW 14 31154872 missense probably damaging 1.00
R2926:Stab1 UTSW 14 31161799 missense probably damaging 1.00
R4025:Stab1 UTSW 14 31154952 missense possibly damaging 0.46
R4113:Stab1 UTSW 14 31168479 missense probably damaging 0.98
R4258:Stab1 UTSW 14 31154672 missense possibly damaging 0.92
R4588:Stab1 UTSW 14 31157445 missense probably benign 0.01
R4644:Stab1 UTSW 14 31140487 unclassified probably benign
R4660:Stab1 UTSW 14 31154915 missense possibly damaging 0.91
R4801:Stab1 UTSW 14 31141371 nonsense probably null
R4802:Stab1 UTSW 14 31141371 nonsense probably null
R4870:Stab1 UTSW 14 31142043 missense probably benign 0.13
R4872:Stab1 UTSW 14 31140393 missense probably damaging 1.00
R4881:Stab1 UTSW 14 31143672 missense probably benign 0.32
R4941:Stab1 UTSW 14 31151571 missense probably benign 0.00
R5061:Stab1 UTSW 14 31163099 missense probably damaging 1.00
R5086:Stab1 UTSW 14 31143624 missense probably damaging 1.00
R5086:Stab1 UTSW 14 31159304 missense probably damaging 1.00
R5087:Stab1 UTSW 14 31159304 missense probably damaging 1.00
R5092:Stab1 UTSW 14 31145855 missense probably benign 0.01
R5102:Stab1 UTSW 14 31148017 critical splice donor site probably null
R5107:Stab1 UTSW 14 31163795 splice site probably null
R5195:Stab1 UTSW 14 31140521 unclassified probably benign
R5217:Stab1 UTSW 14 31159519 missense probably benign 0.25
R5285:Stab1 UTSW 14 31143476 unclassified probably benign
R5327:Stab1 UTSW 14 31161836 nonsense probably null
R5647:Stab1 UTSW 14 31157440 nonsense probably null
R5696:Stab1 UTSW 14 31160221 missense probably benign
R5996:Stab1 UTSW 14 31139551 missense probably benign 0.39
R6016:Stab1 UTSW 14 31158993 missense probably damaging 1.00
R6017:Stab1 UTSW 14 31141544 missense probably benign 0.00
R6174:Stab1 UTSW 14 31162519 nonsense probably null
R6366:Stab1 UTSW 14 31141438 missense probably benign 0.10
R6754:Stab1 UTSW 14 31141081 missense probably benign
R6788:Stab1 UTSW 14 31139160 missense probably damaging 1.00
R6898:Stab1 UTSW 14 31158963 missense probably benign 0.00
R7124:Stab1 UTSW 14 31160867 missense possibly damaging 0.94
R7145:Stab1 UTSW 14 31145073 critical splice donor site probably null
R7153:Stab1 UTSW 14 31160584 missense probably benign 0.16
R7213:Stab1 UTSW 14 31143673 missense probably benign
R7215:Stab1 UTSW 14 31160797 missense possibly damaging 0.93
R7319:Stab1 UTSW 14 31140826 missense probably damaging 1.00
R7389:Stab1 UTSW 14 31147239 missense probably benign 0.00
R7400:Stab1 UTSW 14 31157384 missense probably null 1.00
R7428:Stab1 UTSW 14 31159259 missense probably benign 0.00
R7484:Stab1 UTSW 14 31160317 missense probably benign 0.00
R7568:Stab1 UTSW 14 31152595 missense probably damaging 1.00
R7574:Stab1 UTSW 14 31154665 missense probably benign
R7619:Stab1 UTSW 14 31145237 missense probably benign
R7623:Stab1 UTSW 14 31140621 missense probably benign 0.03
R7721:Stab1 UTSW 14 31141456 missense possibly damaging 0.48
R7869:Stab1 UTSW 14 31154472 missense probably benign 0.01
R7936:Stab1 UTSW 14 31157415 missense possibly damaging 0.88
R7956:Stab1 UTSW 14 31160024 missense probably benign 0.02
R7973:Stab1 UTSW 14 31159633 critical splice donor site probably null
R8059:Stab1 UTSW 14 31160241 missense probably benign 0.02
R8116:Stab1 UTSW 14 31158953 missense possibly damaging 0.80
R8304:Stab1 UTSW 14 31148954 missense probably benign 0.14
R8368:Stab1 UTSW 14 31148411 missense possibly damaging 0.91
R8495:Stab1 UTSW 14 31155833 missense probably damaging 1.00
R8513:Stab1 UTSW 14 31149790 critical splice donor site probably null
R8544:Stab1 UTSW 14 31163051 nonsense probably null
R8671:Stab1 UTSW 14 31157408 missense probably damaging 1.00
R8885:Stab1 UTSW 14 31161814 missense possibly damaging 0.79
R8974:Stab1 UTSW 14 31160822 missense probably benign
R9022:Stab1 UTSW 14 31160269 missense probably benign 0.01
R9059:Stab1 UTSW 14 31154848 missense probably benign 0.01
R9226:Stab1 UTSW 14 31145855 missense probably benign 0.00
R9272:Stab1 UTSW 14 31145341 missense probably benign 0.05
R9388:Stab1 UTSW 14 31154355 missense probably damaging 1.00
R9401:Stab1 UTSW 14 31161112 missense probably benign
R9433:Stab1 UTSW 14 31143574 missense probably benign 0.00
R9450:Stab1 UTSW 14 31162939 missense possibly damaging 0.62
R9505:Stab1 UTSW 14 31155765 missense probably damaging 1.00
R9570:Stab1 UTSW 14 31142681 missense probably benign 0.01
R9624:Stab1 UTSW 14 31141388 missense
R9694:Stab1 UTSW 14 31154944 missense probably benign 0.06
R9723:Stab1 UTSW 14 31163891 missense probably benign 0.10
X0026:Stab1 UTSW 14 31162191 missense possibly damaging 0.91
Z1176:Stab1 UTSW 14 31142038 missense probably benign 0.00
Z1176:Stab1 UTSW 14 31150660 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAAGGCCCTTGCTCTTCTG -3'
(R):5'- GGCCACTACAGGTTCTGATC -3'

Sequencing Primer
(F):5'- ACTATGGCTTTAGCTCATACTGTG -3'
(R):5'- CACTACAGGTTCTGATCTTTCTGGG -3'
Posted On 2019-10-07