Incidental Mutation 'R7427:Kif13b'
ID576207
Institutional Source Beutler Lab
Gene Symbol Kif13b
Ensembl Gene ENSMUSG00000060012
Gene Namekinesin family member 13B
SynonymsN-3 kinesin, C130021D12Rik, 5330429L19Rik, GAKIN
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7427 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location64647265-64809617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64788460 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1422 (I1422T)
Ref Sequence ENSEMBL: ENSMUSP00000098041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100473] [ENSMUST00000224503]
Predicted Effect probably benign
Transcript: ENSMUST00000100473
AA Change: I1422T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098041
Gene: ENSMUSG00000060012
AA Change: I1422T

DomainStartEndE-ValueType
KISc 3 361 1.4e-182 SMART
FHA 470 520 6.86e-1 SMART
low complexity region 546 560 N/A INTRINSIC
coiled coil region 617 646 N/A INTRINSIC
coiled coil region 669 701 N/A INTRINSIC
Pfam:KIF1B 756 802 4.1e-20 PFAM
Pfam:DUF3694 1003 1279 1.4e-37 PFAM
low complexity region 1514 1526 N/A INTRINSIC
low complexity region 1532 1548 N/A INTRINSIC
low complexity region 1574 1589 N/A INTRINSIC
low complexity region 1617 1630 N/A INTRINSIC
CAP_GLY 1719 1784 1.54e-29 SMART
low complexity region 1814 1826 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224503
AA Change: I1422T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (78/78)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit increased circulating cholesterol and factor VIII levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik C T 2: 23,256,994 R337C probably benign Het
Adck5 T A 15: 76,594,385 C318S possibly damaging Het
Aspm T A 1: 139,457,616 C333S probably benign Het
B3gnt4 A G 5: 123,510,731 N53S probably damaging Het
Bpifb5 G A 2: 154,225,122 M98I probably benign Het
Cacna2d3 A G 14: 29,064,275 M585T probably damaging Het
Cbarp T C 10: 80,131,304 D701G probably damaging Het
Cntrl T A 2: 35,170,534 W1913R probably benign Het
Cry2 T C 2: 92,413,047 D483G possibly damaging Het
Csmd1 A G 8: 16,023,850 F2044L possibly damaging Het
Ctgf T G 10: 24,597,499 M312R probably damaging Het
Cxcl16 A G 11: 70,458,804 V78A possibly damaging Het
Cxcr6 A T 9: 123,810,240 Y109F probably benign Het
Cyb5b A G 8: 107,170,416 D106G probably benign Het
D630036H23Rik T C 12: 36,381,538 R154G unknown Het
Dnah9 T C 11: 65,955,219 T2998A probably benign Het
Focad T C 4: 88,368,751 S1254P unknown Het
Gm21886 A T 18: 80,089,652 L97Q probably damaging Het
Gm6614 T G 6: 142,003,508 probably null Het
Gpr158 A C 2: 21,827,318 L1076F probably benign Het
Hivep2 T C 10: 14,133,741 M1714T possibly damaging Het
Hlcs A G 16: 94,267,899 V154A probably benign Het
Hpdl A T 4: 116,820,865 L133Q probably damaging Het
Il1rn C A 2: 24,349,542 T150K probably benign Het
Il6st A G 13: 112,488,560 I237V probably benign Het
Inpp5f A G 7: 128,679,805 D510G probably damaging Het
Ism2 G T 12: 87,286,995 T92K possibly damaging Het
Kit G A 5: 75,645,847 V671I possibly damaging Het
Klhdc8a A T 1: 132,302,967 N190I probably damaging Het
Lad1 C T 1: 135,825,838 T41I probably damaging Het
Lrrc7 G T 3: 158,198,141 T294K probably benign Het
Megf8 C T 7: 25,338,371 R771C probably benign Het
Micu3 A C 8: 40,378,914 N440T possibly damaging Het
Mnx1 T C 5: 29,474,213 N291D unknown Het
Mthfr A G 4: 148,051,603 M378V probably benign Het
Mup2 A T 4: 60,138,454 D79E probably benign Het
Myzap T C 9: 71,505,183 T451A probably benign Het
Nlrp9c T C 7: 26,371,435 D907G probably benign Het
Nr1h4 T C 10: 89,498,405 E41G probably benign Het
Nup98 A T 7: 102,135,001 probably null Het
Nxpe5 A C 5: 138,239,760 Y194S probably damaging Het
Olfr1024 T A 2: 85,904,131 R308* probably null Het
Olfr1032 A T 2: 86,008,219 I148L probably benign Het
Olfr105-ps T C 17: 37,383,299 V244A probably damaging Het
Olfr1121 G T 2: 87,371,690 V53L probably benign Het
Olfr332 A G 11: 58,489,780 I325T probably benign Het
Olfr466 A G 13: 65,153,052 Y276C probably damaging Het
Olfr554 A G 7: 102,640,326 I27V probably benign Het
Omd A T 13: 49,592,269 E385V possibly damaging Het
Pcdh9 G T 14: 93,887,111 T541K probably damaging Het
Pdia6 T C 12: 17,278,545 V167A probably damaging Het
Phf7 C T 14: 31,240,413 R145Q possibly damaging Het
Pitx3 T C 19: 46,137,424 D20G possibly damaging Het
Plxnb1 T C 9: 109,108,168 V1139A probably benign Het
Pon2 A T 6: 5,268,995 N226K probably damaging Het
Ppp1r10 T A 17: 35,930,133 H642Q possibly damaging Het
Prom2 A G 2: 127,539,811 L195P probably damaging Het
Psg23 C T 7: 18,611,983 probably null Het
Rfx4 C A 10: 84,896,012 Q618K probably benign Het
Rhobtb1 T A 10: 69,248,824 I15N probably damaging Het
Rhot2 A T 17: 25,841,609 V233E probably damaging Het
Ripply2 T C 9: 87,019,756 S112P possibly damaging Het
Slc12a1 C A 2: 125,214,132 T861N probably benign Het
Slc35f1 T A 10: 53,089,414 S308R probably damaging Het
Slc35f4 T A 14: 49,298,898 I427F probably damaging Het
Sned1 G A 1: 93,289,358 V1322I probably benign Het
Sprr2f G A 3: 92,365,944 V17M unknown Het
Srd5a3 A G 5: 76,154,643 H285R probably benign Het
Stab1 T C 14: 31,159,259 T605A probably benign Het
Syne1 T C 10: 5,273,718 Q3054R probably damaging Het
Tas1r1 T C 4: 152,038,308 T27A probably benign Het
Tmem150b A T 7: 4,716,210 V237E probably benign Het
Trpv6 C T 6: 41,625,153 M407I probably benign Het
Ttn T G 2: 76,720,354 D31528A probably damaging Het
Uroc1 A T 6: 90,346,362 D354V possibly damaging Het
Vmn2r69 T C 7: 85,411,259 I372M probably benign Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Zfp971 T A 2: 178,033,174 C189S probably damaging Het
Other mutations in Kif13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Kif13b APN 14 64669693 missense possibly damaging 0.81
IGL00485:Kif13b APN 14 64765073 missense possibly damaging 0.88
IGL00495:Kif13b APN 14 64714113 missense probably benign 0.07
IGL00556:Kif13b APN 14 64744888 missense probably damaging 1.00
IGL00571:Kif13b APN 14 64746417 missense probably damaging 0.99
IGL00590:Kif13b APN 14 64779462 missense probably damaging 1.00
IGL01650:Kif13b APN 14 64765145 missense probably benign 0.00
IGL01730:Kif13b APN 14 64750361 critical splice donor site probably null
IGL01908:Kif13b APN 14 64757558 missense probably damaging 1.00
IGL02388:Kif13b APN 14 64800358 missense probably damaging 1.00
IGL02573:Kif13b APN 14 64803431 missense probably damaging 1.00
IGL02661:Kif13b APN 14 64767691 missense probably benign 0.06
IGL02794:Kif13b APN 14 64803440 missense probably benign 0.00
IGL02959:Kif13b APN 14 64767717 missense probably damaging 1.00
IGL02979:Kif13b APN 14 64789697 missense probably damaging 0.96
IGL03114:Kif13b APN 14 64788448 missense probably benign 0.00
R0024:Kif13b UTSW 14 64750273 missense probably benign 0.30
R0330:Kif13b UTSW 14 64803220 missense probably benign
R0376:Kif13b UTSW 14 64757404 splice site probably benign
R0571:Kif13b UTSW 14 64751528 missense probably damaging 1.00
R0718:Kif13b UTSW 14 64751662 splice site probably benign
R1144:Kif13b UTSW 14 64714117 missense probably benign 0.01
R1183:Kif13b UTSW 14 64782377 missense probably benign 0.00
R1264:Kif13b UTSW 14 64776232 splice site probably benign
R1497:Kif13b UTSW 14 64736266 missense probably damaging 0.99
R1579:Kif13b UTSW 14 64782341 critical splice acceptor site probably null
R1624:Kif13b UTSW 14 64738619 missense probably damaging 0.99
R1706:Kif13b UTSW 14 64760666 splice site probably benign
R2176:Kif13b UTSW 14 64669671 missense probably benign 0.01
R3727:Kif13b UTSW 14 64765748 splice site probably benign
R3785:Kif13b UTSW 14 64800400 missense probably benign 0.00
R3786:Kif13b UTSW 14 64800400 missense probably benign 0.00
R4088:Kif13b UTSW 14 64767455 critical splice donor site probably null
R4279:Kif13b UTSW 14 64779356 missense probably damaging 1.00
R4559:Kif13b UTSW 14 64806132 missense probably damaging 0.98
R4689:Kif13b UTSW 14 64773064 missense probably damaging 1.00
R4692:Kif13b UTSW 14 64803575 missense probably benign 0.05
R4878:Kif13b UTSW 14 64806154 missense probably benign 0.00
R4971:Kif13b UTSW 14 64757562 missense possibly damaging 0.90
R5037:Kif13b UTSW 14 64758589 nonsense probably null
R5119:Kif13b UTSW 14 64757453 missense probably benign 0.01
R5167:Kif13b UTSW 14 64772935 missense probably damaging 1.00
R5408:Kif13b UTSW 14 64779689 critical splice acceptor site probably null
R5437:Kif13b UTSW 14 64806114 missense probably damaging 0.99
R5756:Kif13b UTSW 14 64736305 missense probably damaging 1.00
R5838:Kif13b UTSW 14 64737555 missense probably damaging 1.00
R5891:Kif13b UTSW 14 64788405 splice site probably null
R6120:Kif13b UTSW 14 64751558 missense probably damaging 1.00
R6150:Kif13b UTSW 14 64751639 missense probably damaging 0.99
R6165:Kif13b UTSW 14 64742311 missense probably damaging 1.00
R6187:Kif13b UTSW 14 64736215 missense probably damaging 1.00
R6229:Kif13b UTSW 14 64738567 missense probably damaging 1.00
R6267:Kif13b UTSW 14 64738634 missense probably damaging 1.00
R6347:Kif13b UTSW 14 64767619 missense probably benign 0.26
R6479:Kif13b UTSW 14 64751525 missense probably benign 0.08
R6512:Kif13b UTSW 14 64744874 critical splice acceptor site probably null
R6851:Kif13b UTSW 14 64773065 missense probably damaging 1.00
R7131:Kif13b UTSW 14 64773068 missense probably damaging 1.00
R7217:Kif13b UTSW 14 64773068 missense probably damaging 1.00
R7398:Kif13b UTSW 14 64757523 missense probably null 0.02
R7428:Kif13b UTSW 14 64788460 missense probably benign
R7573:Kif13b UTSW 14 64803658 missense probably benign 0.00
R7629:Kif13b UTSW 14 64779335 nonsense probably null
R7683:Kif13b UTSW 14 64757507 missense probably benign 0.24
R7835:Kif13b UTSW 14 64767452 missense probably benign 0.00
R7895:Kif13b UTSW 14 64736149 missense probably damaging 1.00
R7918:Kif13b UTSW 14 64767452 missense probably benign 0.00
R7978:Kif13b UTSW 14 64736149 missense probably damaging 1.00
Z1176:Kif13b UTSW 14 64803344 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCATCCCAGAGAATAGCGTTTTAG -3'
(R):5'- TACAGGGTAACGTCACCACC -3'

Sequencing Primer
(F):5'- CCCAGAGAATAGCGTTTTAGTAATGC -3'
(R):5'- ATAGGTGACATTCTGATGGACATG -3'
Posted On2019-10-07