Incidental Mutation 'R7427:Pitx3'
ID 576216
Institutional Source Beutler Lab
Gene Symbol Pitx3
Ensembl Gene ENSMUSG00000025229
Gene Name paired-like homeodomain transcription factor 3
Synonyms Ptx3
MMRRC Submission 045505-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7427 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 46124124-46136765 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 46125863 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 20 (D20G)
Ref Sequence ENSEMBL: ENSMUSP00000026259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026259] [ENSMUST00000043739] [ENSMUST00000172971]
AlphaFold O35160
Predicted Effect possibly damaging
Transcript: ENSMUST00000026259
AA Change: D20G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000026259
Gene: ENSMUSG00000025229
AA Change: D20G

DomainStartEndE-ValueType
HOX 62 124 3.48e-26 SMART
low complexity region 157 174 N/A INTRINSIC
low complexity region 189 236 N/A INTRINSIC
low complexity region 240 252 N/A INTRINSIC
Pfam:OAR 258 276 3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043739
SMART Domains Protein: ENSMUSP00000036357
Gene: ENSMUSG00000038754

DomainStartEndE-ValueType
Pfam:ELO 30 267 2.9e-66 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172971
AA Change: D20G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134563
Gene: ENSMUSG00000025229
AA Change: D20G

DomainStartEndE-ValueType
Pfam:Homeobox 63 91 1e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RIEG/PITX homeobox family, which is in the bicoid class of homeodomain proteins. Members of this family act as transcription factors. This protein is involved in lens formation during eye development. Mutations of this gene have been associated with anterior segment mesenchymal dysgenesis and congenital cataracts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene cause variable defects in many aspects of ocular development and loss of a subset of midbrain dopaminergic neurons. Observed phenotypes may include growth abnormalities, alterations in liver, lung, and bone function, and sex-specific neurobehavioral anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck5 T A 15: 76,478,585 (GRCm39) C318S possibly damaging Het
Aspm T A 1: 139,385,354 (GRCm39) C333S probably benign Het
B3gnt4 A G 5: 123,648,794 (GRCm39) N53S probably damaging Het
Bpifb5 G A 2: 154,067,042 (GRCm39) M98I probably benign Het
Cacna2d3 A G 14: 28,786,232 (GRCm39) M585T probably damaging Het
Cbarp T C 10: 79,967,138 (GRCm39) D701G probably damaging Het
Ccn2 T G 10: 24,473,397 (GRCm39) M312R probably damaging Het
Cntrl T A 2: 35,060,546 (GRCm39) W1913R probably benign Het
Cry2 T C 2: 92,243,392 (GRCm39) D483G possibly damaging Het
Csmd1 A G 8: 16,073,864 (GRCm39) F2044L possibly damaging Het
Cxcl16 A G 11: 70,349,630 (GRCm39) V78A possibly damaging Het
Cxcr6 A T 9: 123,639,305 (GRCm39) Y109F probably benign Het
Cyb5b A G 8: 107,897,048 (GRCm39) D106G probably benign Het
D630036H23Rik T C 12: 36,431,537 (GRCm39) R154G unknown Het
Dnah9 T C 11: 65,846,045 (GRCm39) T2998A probably benign Het
Focad T C 4: 88,286,988 (GRCm39) S1254P unknown Het
Gm21886 A T 18: 80,132,867 (GRCm39) L97Q probably damaging Het
Gpr158 A C 2: 21,832,129 (GRCm39) L1076F probably benign Het
Hivep2 T C 10: 14,009,485 (GRCm39) M1714T possibly damaging Het
Hlcs A G 16: 94,068,758 (GRCm39) V154A probably benign Het
Hpdl A T 4: 116,678,062 (GRCm39) L133Q probably damaging Het
Il1rn C A 2: 24,239,554 (GRCm39) T150K probably benign Het
Il6st A G 13: 112,625,094 (GRCm39) I237V probably benign Het
Inpp5f A G 7: 128,281,529 (GRCm39) D510G probably damaging Het
Ism2 G T 12: 87,333,769 (GRCm39) T92K possibly damaging Het
Kif13b T C 14: 65,025,909 (GRCm39) I1422T probably benign Het
Kit G A 5: 75,806,507 (GRCm39) V671I possibly damaging Het
Klhdc8a A T 1: 132,230,705 (GRCm39) N190I probably damaging Het
Lad1 C T 1: 135,753,576 (GRCm39) T41I probably damaging Het
Lrrc7 G T 3: 157,903,778 (GRCm39) T294K probably benign Het
Megf8 C T 7: 25,037,796 (GRCm39) R771C probably benign Het
Micu3 A C 8: 40,831,955 (GRCm39) N440T possibly damaging Het
Mnx1 T C 5: 29,679,211 (GRCm39) N291D unknown Het
Mthfr A G 4: 148,136,060 (GRCm39) M378V probably benign Het
Mup2 A T 4: 60,138,454 (GRCm39) D79E probably benign Het
Myzap T C 9: 71,412,465 (GRCm39) T451A probably benign Het
Nlrp9c T C 7: 26,070,860 (GRCm39) D907G probably benign Het
Nr1h4 T C 10: 89,334,267 (GRCm39) E41G probably benign Het
Nup98 A T 7: 101,784,208 (GRCm39) probably null Het
Nxpe5 A C 5: 138,238,022 (GRCm39) Y194S probably damaging Het
Omd A T 13: 49,745,745 (GRCm39) E385V possibly damaging Het
Or12d15 T C 17: 37,694,190 (GRCm39) V244A probably damaging Het
Or12e9 G T 2: 87,202,034 (GRCm39) V53L probably benign Het
Or2av9 A G 11: 58,380,606 (GRCm39) I325T probably benign Het
Or52m1 A G 7: 102,289,533 (GRCm39) I27V probably benign Het
Or5m12 T A 2: 85,734,475 (GRCm39) R308* probably null Het
Or5m3 A T 2: 85,838,563 (GRCm39) I148L probably benign Het
Or9s18 A G 13: 65,300,866 (GRCm39) Y276C probably damaging Het
Pcdh9 G T 14: 94,124,547 (GRCm39) T541K probably damaging Het
Pdia6 T C 12: 17,328,546 (GRCm39) V167A probably damaging Het
Phf7 C T 14: 30,962,370 (GRCm39) R145Q possibly damaging Het
Plxnb1 T C 9: 108,937,236 (GRCm39) V1139A probably benign Het
Pon2 A T 6: 5,268,995 (GRCm39) N226K probably damaging Het
Potegl C T 2: 23,147,006 (GRCm39) R337C probably benign Het
Ppp1r10 T A 17: 36,241,025 (GRCm39) H642Q possibly damaging Het
Prom2 A G 2: 127,381,731 (GRCm39) L195P probably damaging Het
Psg23 C T 7: 18,345,908 (GRCm39) probably null Het
Rfx4 C A 10: 84,731,876 (GRCm39) Q618K probably benign Het
Rhobtb1 T A 10: 69,084,654 (GRCm39) I15N probably damaging Het
Rhot2 A T 17: 26,060,583 (GRCm39) V233E probably damaging Het
Ripply2 T C 9: 86,901,809 (GRCm39) S112P possibly damaging Het
Slc12a1 C A 2: 125,056,052 (GRCm39) T861N probably benign Het
Slc35f1 T A 10: 52,965,510 (GRCm39) S308R probably damaging Het
Slc35f4 T A 14: 49,536,355 (GRCm39) I427F probably damaging Het
Slco1a8 T G 6: 141,949,234 (GRCm39) probably null Het
Sned1 G A 1: 93,217,080 (GRCm39) V1322I probably benign Het
Sprr2f G A 3: 92,273,251 (GRCm39) V17M unknown Het
Srd5a3 A G 5: 76,302,490 (GRCm39) H285R probably benign Het
Stab1 T C 14: 30,881,216 (GRCm39) T605A probably benign Het
Syne1 T C 10: 5,223,718 (GRCm39) Q3054R probably damaging Het
Tas1r1 T C 4: 152,122,765 (GRCm39) T27A probably benign Het
Tmem150b A T 7: 4,719,209 (GRCm39) V237E probably benign Het
Trpv6 C T 6: 41,602,087 (GRCm39) M407I probably benign Het
Ttn T G 2: 76,550,698 (GRCm39) D31528A probably damaging Het
Uroc1 A T 6: 90,323,344 (GRCm39) D354V possibly damaging Het
Vmn2r69 T C 7: 85,060,467 (GRCm39) I372M probably benign Het
Vmn2r93 A T 17: 18,546,672 (GRCm39) H848L probably benign Het
Zfp971 T A 2: 177,674,967 (GRCm39) C189S probably damaging Het
Other mutations in Pitx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1853:Pitx3 UTSW 19 46,125,912 (GRCm39) missense probably benign 0.34
R2046:Pitx3 UTSW 19 46,125,618 (GRCm39) missense possibly damaging 0.72
R2190:Pitx3 UTSW 19 46,125,486 (GRCm39) missense probably damaging 0.98
R3547:Pitx3 UTSW 19 46,124,548 (GRCm39) missense possibly damaging 0.93
R4666:Pitx3 UTSW 19 46,125,540 (GRCm39) missense possibly damaging 0.93
R5869:Pitx3 UTSW 19 46,125,735 (GRCm39) intron probably benign
R8970:Pitx3 UTSW 19 46,125,540 (GRCm39) missense possibly damaging 0.93
R9745:Pitx3 UTSW 19 46,124,660 (GRCm39) missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TCAGGGGCCTCAAGGAATTC -3'
(R):5'- ACCCTATTAGGAGCCTGATAAATC -3'

Sequencing Primer
(F):5'- AGGAATTCCTCAGCCCCTG -3'
(R):5'- TGGTTGACCAGGTACACACTG -3'
Posted On 2019-10-07