Mutagenetix > Incidental Mutations

Incidental Mutation 'R7428:Nup205'

576239

Institutional Source

Beutler Lab

Gene Symbol

Nup205

Ensembl Gene

ENSMUSG00000038759

Gene Name

nucleoporin 205

Synonyms

3830404O05Rik

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_027513.1; MGI:2141625

Is this an essential gene?

Probably essential (E-score: 0.957) question?

Stock #

R7428 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

35177421-35247596 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 35227559 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1460 (I1460N)

Ref Sequence

ENSEMBL: ENSMUSP00000144126 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043815] [ENSMUST00000170234] [ENSMUST00000201374]

AlphaFold

A0A0J9YUD5

Predicted Effect

probably damaging
Transcript: ENSMUST00000043815
AA Change: I1407N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000039656
Gene: ENSMUSG00000038759
AA Change: I1407N

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
Pfam:Nup192	14	1684	N/A	PFAM
low complexity region	1995	2005	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170234

SMART Domains

Protein: ENSMUSP00000130033
Gene: ENSMUSG00000038759

Domain	Start	End	E-Value	Type
Pfam:DUF3414	13	322	9.7e-98	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000201374
AA Change: I1460N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000144126
Gene: ENSMUSG00000038759
AA Change: I1460N

Domain	Start	End	E-Value	Type
low complexity region	36	50	N/A	INTRINSIC
Pfam:Nup192	67	1737	N/A	PFAM
low complexity region	2048	2058	N/A	INTRINSIC

Meta Mutation Damage Score

0.8918

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleoporin, which is a subunit of the nuclear pore complex that functions in active transport of proteins, RNAs and ribonucleoprotein particles between the nucleus and cytoplasm. Mutations in this gene are associated with steroid-resistant nephrotic syndrome. [provided by RefSeq, Jul 2016]

Allele List at MGI

All alleles(32) : Targeted(2) Gene trapped(30)

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anxa10	T	A	8: 62,092,509	Y63F	probably benign	Het
Atl2	T	C	17: 79,875,798		probably null	Het
B3gnt4	A	G	5: 123,510,731	N53S	probably damaging	Het
Bpifb5	G	A	2: 154,225,122	M98I	probably benign	Het
Cacna2d3	A	G	14: 29,064,275	M585T	probably damaging	Het
Cbarp	T	C	10: 80,131,304	D701G	probably damaging	Het
Cep295	A	G	9: 15,333,498	S1221P	possibly damaging	Het
Cep350	T	C	1: 155,894,619	S1842G	probably benign	Het
Cntrl	T	A	2: 35,170,534	W1913R	probably benign	Het
Creb5	C	A	6: 53,681,158	Q158K	unknown	Het
Crtam	G	C	9: 40,981,182	A266G	probably benign	Het
Cry2	T	C	2: 92,413,047	D483G	possibly damaging	Het
Csmd1	A	G	8: 16,023,850	F2044L	possibly damaging	Het
Cxcr6	A	T	9: 123,810,240	Y109F	probably benign	Het
Cyb5b	A	G	8: 107,170,416	D106G	probably benign	Het
D630036H23Rik	T	C	12: 36,381,538	R154G	unknown	Het
Ddit4l	A	G	3: 137,626,170	E99G	probably damaging	Het
Dmbt1	A	T	7: 131,108,463	T1495S	possibly damaging	Het
Gm21886	A	T	18: 80,089,652	L97Q	probably damaging	Het
Hlcs	A	G	16: 94,267,899	V154A	probably benign	Het
Hpdl	A	T	4: 116,820,865	L133Q	probably damaging	Het
Inpp5f	A	G	7: 128,679,805	D510G	probably damaging	Het
Ism2	G	T	12: 87,286,995	T92K	possibly damaging	Het
Kif13b	T	C	14: 64,788,460	I1422T	probably benign	Het
Leng8	C	T	7: 4,143,573	R395W	probably damaging	Het
Mocs2	A	G	13: 114,820,864	I6V	probably benign	Het
Mthfr	A	G	4: 148,051,603	M378V	probably benign	Het
Myh13	A	G	11: 67,332,564	T237A	probably damaging	Het
Nr1h4	T	C	10: 89,498,405	E41G	probably benign	Het
Nup98	A	T	7: 102,135,001		probably null	Het
Nxpe5	A	C	5: 138,239,760	Y194S	probably damaging	Het
Olfr1024	T	A	2: 85,904,131	R308*	probably null	Het
Olfr1032	A	T	2: 86,008,219	I148L	probably benign	Het
Olfr1121	G	T	2: 87,371,690	V53L	probably benign	Het
Olfr466	A	G	13: 65,153,052	Y276C	probably damaging	Het
Olfr554	A	G	7: 102,640,326	I27V	probably benign	Het
Otof	G	T	5: 30,389,825	D383E	probably damaging	Het
Pcdh9	G	T	14: 93,887,111	T541K	probably damaging	Het
Pclo	A	T	5: 14,750,517	I1179F		Het
Pde6c	T	C	19: 38,157,536		probably null	Het
Pdia6	T	C	12: 17,278,545	V167A	probably damaging	Het
Phf7	C	T	14: 31,240,413	R145Q	possibly damaging	Het
Plxnb1	T	C	9: 109,108,168	V1139A	probably benign	Het
Prkg1	T	C	19: 30,578,835	I585M	probably damaging	Het
Prom2	A	G	2: 127,539,811	L195P	probably damaging	Het
Ptprd	G	A	4: 76,086,468	P17S	probably benign	Het
Rfx4	C	A	10: 84,896,012	Q618K	probably benign	Het
Rhobtb1	T	A	10: 69,248,824	I15N	probably damaging	Het
Sap30	C	T	8: 57,487,512	V19M	possibly damaging	Het
Scrib	G	A	15: 76,061,198	T721M	probably damaging	Het
Slc12a1	C	A	2: 125,214,132	T861N	probably benign	Het
Slc35f1	T	A	10: 53,089,414	S308R	probably damaging	Het
Slc35f4	T	A	14: 49,298,898	I427F	probably damaging	Het
Slco4c1	T	C	1: 96,837,520	T402A	possibly damaging	Het
Sprr2f	G	A	3: 92,365,944	V17M	unknown	Het
Stab1	T	C	14: 31,159,259	T605A	probably benign	Het
Taar8c	A	C	10: 24,101,548	L122R	probably damaging	Het
Tbc1d2	G	A	4: 46,649,965	P24S	probably benign	Het
Tex36	T	C	7: 133,595,137		probably null	Het
Tmem145	T	C	7: 25,307,165		probably null	Het
Ttn	T	G	2: 76,720,354	D31528A	probably damaging	Het
Vars2	A	T	17: 35,666,686	V118E	probably benign	Het
Vmn1r195	T	C	13: 22,278,852	V164A	probably benign	Het
Vmn2r69	T	C	7: 85,411,259	I372M	probably benign	Het
Vmn2r93	A	T	17: 18,326,410	H848L	probably benign	Het
Wnt9b	T	C	11: 103,730,817	Q338R	probably benign	Het
Zfp128	A	G	7: 12,890,362	D219G	probably benign	Het
Zfp541	A	T	7: 16,092,868	R1181W	probably damaging	Het
Zfp867	C	T	11: 59,463,934	G190S	probably benign	Het
Zfp971	T	A	2: 178,033,174	C189S	probably damaging	Het

Other mutations in Nup205

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Nup205	APN	6	35214802	missense	probably damaging	1.00
IGL01086:Nup205	APN	6	35208936	splice site	probably benign
IGL01138:Nup205	APN	6	35208084	nonsense	probably null
IGL01333:Nup205	APN	6	35241063	missense	probably benign
IGL01399:Nup205	APN	6	35219689	missense	possibly damaging	0.80
IGL01466:Nup205	APN	6	35199959	missense	probably benign	0.08
IGL01913:Nup205	APN	6	35227430	missense	probably benign	0.10
IGL02159:Nup205	APN	6	35189178	missense	probably damaging	1.00
IGL02442:Nup205	APN	6	35190068	missense	probably benign	0.01
IGL02447:Nup205	APN	6	35227576	splice site	probably null
IGL02558:Nup205	APN	6	35189924	missense	probably damaging	1.00
IGL03306:Nup205	APN	6	35208169	missense	probably damaging	0.98
IGL03328:Nup205	APN	6	35232414	missense	probably damaging	0.99
Figaro	UTSW	6	35196714	splice site	probably null
Marcellina	UTSW	6	35183969	missense	probably damaging	1.00
Spirit	UTSW	6	35232408	missense	probably damaging	0.98
Susanna	UTSW	6	35208109	missense	possibly damaging	0.94
voyager	UTSW	6	35189885	missense	possibly damaging	0.80
BB007:Nup205	UTSW	6	35194576	missense	probably damaging	0.98
BB017:Nup205	UTSW	6	35194576	missense	probably damaging	0.98
P0012:Nup205	UTSW	6	35196543	missense	possibly damaging	0.90
R0102:Nup205	UTSW	6	35225780	splice site	probably benign
R0102:Nup205	UTSW	6	35225780	splice site	probably benign
R0362:Nup205	UTSW	6	35196714	splice site	probably null
R0374:Nup205	UTSW	6	35208837	missense	probably damaging	1.00
R0415:Nup205	UTSW	6	35214634	splice site	probably benign
R0427:Nup205	UTSW	6	35194463	missense	probably benign	0.01
R0543:Nup205	UTSW	6	35198969	missense	probably benign
R0611:Nup205	UTSW	6	35225968	missense	probably null	1.00
R0761:Nup205	UTSW	6	35196428	splice site	probably benign
R0828:Nup205	UTSW	6	35194566	missense	probably benign
R0906:Nup205	UTSW	6	35236892	missense	probably damaging	1.00
R1023:Nup205	UTSW	6	35234706	missense	probably damaging	0.98
R1033:Nup205	UTSW	6	35227442	missense	probably benign
R1375:Nup205	UTSW	6	35200071	splice site	probably benign
R1447:Nup205	UTSW	6	35215185	missense	probably benign	0.00
R1468:Nup205	UTSW	6	35225982	critical splice donor site	probably null
R1468:Nup205	UTSW	6	35225982	critical splice donor site	probably null
R1625:Nup205	UTSW	6	35191943	missense	probably benign	0.31
R1652:Nup205	UTSW	6	35238966	missense	probably benign
R1659:Nup205	UTSW	6	35234788	missense	probably benign	0.02
R1693:Nup205	UTSW	6	35210971	missense	probably benign	0.05
R1769:Nup205	UTSW	6	35205431	missense	probably damaging	1.00
R1839:Nup205	UTSW	6	35219714	missense	probably benign	0.00
R1959:Nup205	UTSW	6	35233366	missense	probably benign	0.16
R2051:Nup205	UTSW	6	35230516	missense	probably benign	0.29
R2267:Nup205	UTSW	6	35241349	missense	possibly damaging	0.67
R2401:Nup205	UTSW	6	35208134	nonsense	probably null
R3697:Nup205	UTSW	6	35188711	missense	probably benign	0.15
R3938:Nup205	UTSW	6	35219742	missense	probably damaging	1.00
R4074:Nup205	UTSW	6	35192040	critical splice donor site	probably null
R4117:Nup205	UTSW	6	35241012	nonsense	probably null
R4364:Nup205	UTSW	6	35192027	missense	probably benign	0.38
R4366:Nup205	UTSW	6	35192027	missense	probably benign	0.38
R4594:Nup205	UTSW	6	35196489	missense	probably benign	0.00
R4706:Nup205	UTSW	6	35202008	missense	probably damaging	1.00
R4787:Nup205	UTSW	6	35202061	missense	probably damaging	1.00
R4849:Nup205	UTSW	6	35230570	missense	possibly damaging	0.90
R4850:Nup205	UTSW	6	35230530	missense	probably benign	0.16
R4943:Nup205	UTSW	6	35224639	missense	probably damaging	1.00
R4966:Nup205	UTSW	6	35243849	missense	probably benign	0.00
R5138:Nup205	UTSW	6	35225866	missense	probably damaging	1.00
R5251:Nup205	UTSW	6	35196482	splice site	probably null
R5444:Nup205	UTSW	6	35189189	missense	probably damaging	0.98
R5760:Nup205	UTSW	6	35247343	missense	probably damaging	1.00
R5762:Nup205	UTSW	6	35227680	missense	probably damaging	1.00
R5762:Nup205	UTSW	6	35230548	missense	probably damaging	0.96
R5941:Nup205	UTSW	6	35232408	missense	probably damaging	0.98
R5969:Nup205	UTSW	6	35177578	unclassified	probably benign
R6003:Nup205	UTSW	6	35212816	missense	probably benign
R6178:Nup205	UTSW	6	35243843	missense	possibly damaging	0.85
R6315:Nup205	UTSW	6	35236869	missense	probably damaging	1.00
R6392:Nup205	UTSW	6	35189885	missense	possibly damaging	0.80
R6710:Nup205	UTSW	6	35247373	missense	probably benign	0.00
R6954:Nup205	UTSW	6	35208109	missense	possibly damaging	0.94
R7022:Nup205	UTSW	6	35243936	missense	probably benign	0.45
R7041:Nup205	UTSW	6	35224535	missense	possibly damaging	0.49
R7052:Nup205	UTSW	6	35215142	missense	possibly damaging	0.81
R7310:Nup205	UTSW	6	35225969	missense	possibly damaging	0.78
R7363:Nup205	UTSW	6	35232573	missense	probably benign	0.28
R7399:Nup205	UTSW	6	35214676	missense	probably damaging	0.99
R7553:Nup205	UTSW	6	35201999	missense	probably damaging	1.00
R7665:Nup205	UTSW	6	35177620	missense	possibly damaging	0.46
R7841:Nup205	UTSW	6	35247437	missense	unknown
R7930:Nup205	UTSW	6	35194576	missense	probably damaging	0.98
R7973:Nup205	UTSW	6	35245339	missense	probably benign
R7976:Nup205	UTSW	6	35198953	missense	probably damaging	1.00
R8073:Nup205	UTSW	6	35202169	critical splice donor site	probably null
R8080:Nup205	UTSW	6	35227376	missense	probably damaging	1.00
R8118:Nup205	UTSW	6	35230516	missense	probably benign	0.29
R8213:Nup205	UTSW	6	35225203	missense	probably benign	0.26
R8237:Nup205	UTSW	6	35227503	missense	possibly damaging	0.89
R8408:Nup205	UTSW	6	35225247	missense	probably damaging	1.00
R8807:Nup205	UTSW	6	35183969	missense	probably damaging	1.00
R8812:Nup205	UTSW	6	35214334	missense	probably damaging	1.00
R9261:Nup205	UTSW	6	35199857	missense	probably benign	0.00
R9403:Nup205	UTSW	6	35199974	missense	probably benign	0.45
Z1177:Nup205	UTSW	6	35177605	missense	unknown
Z1177:Nup205	UTSW	6	35208793	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCACCCTGACTGCTCACCTAAG -3'
(R):5'- TCTAGTGTGTCCGGCTCATC -3'

Sequencing Primer
(F):5'- TAAGCCAGGCTGTGCGC -3'
(R):5'- CATCTGGTCTCTGGGCAATCTG -3'

Posted On

2019-10-07