Incidental Mutation 'R7428:Nup205'
ID 576239
Institutional Source Beutler Lab
Gene Symbol Nup205
Ensembl Gene ENSMUSG00000038759
Gene Name nucleoporin 205
Synonyms 3830404O05Rik
MMRRC Submission 045506-MU
Accession Numbers

NCBI RefSeq: NM_027513.1; MGI:2141625

Essential gene? Probably essential (E-score: 0.962) question?
Stock # R7428 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 35177421-35247596 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 35227559 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 1460 (I1460N)
Ref Sequence ENSEMBL: ENSMUSP00000144126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043815] [ENSMUST00000170234] [ENSMUST00000201374]
AlphaFold A0A0J9YUD5
Predicted Effect probably damaging
Transcript: ENSMUST00000043815
AA Change: I1407N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039656
Gene: ENSMUSG00000038759
AA Change: I1407N

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Nup192 14 1684 N/A PFAM
low complexity region 1995 2005 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170234
SMART Domains Protein: ENSMUSP00000130033
Gene: ENSMUSG00000038759

DomainStartEndE-ValueType
Pfam:DUF3414 13 322 9.7e-98 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201374
AA Change: I1460N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144126
Gene: ENSMUSG00000038759
AA Change: I1460N

DomainStartEndE-ValueType
low complexity region 36 50 N/A INTRINSIC
Pfam:Nup192 67 1737 N/A PFAM
low complexity region 2048 2058 N/A INTRINSIC
Meta Mutation Damage Score 0.8918 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleoporin, which is a subunit of the nuclear pore complex that functions in active transport of proteins, RNAs and ribonucleoprotein particles between the nucleus and cytoplasm. Mutations in this gene are associated with steroid-resistant nephrotic syndrome. [provided by RefSeq, Jul 2016]
Allele List at MGI

All alleles(32) : Targeted(2) Gene trapped(30)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa10 T A 8: 62,092,509 Y63F probably benign Het
Atl2 T C 17: 79,875,798 probably null Het
B3gnt4 A G 5: 123,510,731 N53S probably damaging Het
Bpifb5 G A 2: 154,225,122 M98I probably benign Het
Cacna2d3 A G 14: 29,064,275 M585T probably damaging Het
Cbarp T C 10: 80,131,304 D701G probably damaging Het
Cep295 A G 9: 15,333,498 S1221P possibly damaging Het
Cep350 T C 1: 155,894,619 S1842G probably benign Het
Cntrl T A 2: 35,170,534 W1913R probably benign Het
Creb5 C A 6: 53,681,158 Q158K unknown Het
Crtam G C 9: 40,981,182 A266G probably benign Het
Cry2 T C 2: 92,413,047 D483G possibly damaging Het
Csmd1 A G 8: 16,023,850 F2044L possibly damaging Het
Cxcr6 A T 9: 123,810,240 Y109F probably benign Het
Cyb5b A G 8: 107,170,416 D106G probably benign Het
D630036H23Rik T C 12: 36,381,538 R154G unknown Het
Ddit4l A G 3: 137,626,170 E99G probably damaging Het
Dmbt1 A T 7: 131,108,463 T1495S possibly damaging Het
Gm21886 A T 18: 80,089,652 L97Q probably damaging Het
Hlcs A G 16: 94,267,899 V154A probably benign Het
Hpdl A T 4: 116,820,865 L133Q probably damaging Het
Inpp5f A G 7: 128,679,805 D510G probably damaging Het
Ism2 G T 12: 87,286,995 T92K possibly damaging Het
Kif13b T C 14: 64,788,460 I1422T probably benign Het
Leng8 C T 7: 4,143,573 R395W probably damaging Het
Mocs2 A G 13: 114,820,864 I6V probably benign Het
Mthfr A G 4: 148,051,603 M378V probably benign Het
Myh13 A G 11: 67,332,564 T237A probably damaging Het
Nr1h4 T C 10: 89,498,405 E41G probably benign Het
Nup98 A T 7: 102,135,001 probably null Het
Nxpe5 A C 5: 138,239,760 Y194S probably damaging Het
Olfr1024 T A 2: 85,904,131 R308* probably null Het
Olfr1032 A T 2: 86,008,219 I148L probably benign Het
Olfr1121 G T 2: 87,371,690 V53L probably benign Het
Olfr466 A G 13: 65,153,052 Y276C probably damaging Het
Olfr554 A G 7: 102,640,326 I27V probably benign Het
Otof G T 5: 30,389,825 D383E probably damaging Het
Pcdh9 G T 14: 93,887,111 T541K probably damaging Het
Pclo A T 5: 14,750,517 I1179F Het
Pde6c T C 19: 38,157,536 probably null Het
Pdia6 T C 12: 17,278,545 V167A probably damaging Het
Phf7 C T 14: 31,240,413 R145Q possibly damaging Het
Plxnb1 T C 9: 109,108,168 V1139A probably benign Het
Prkg1 T C 19: 30,578,835 I585M probably damaging Het
Prom2 A G 2: 127,539,811 L195P probably damaging Het
Ptprd G A 4: 76,086,468 P17S probably benign Het
Rfx4 C A 10: 84,896,012 Q618K probably benign Het
Rhobtb1 T A 10: 69,248,824 I15N probably damaging Het
Sap30 C T 8: 57,487,512 V19M possibly damaging Het
Scrib G A 15: 76,061,198 T721M probably damaging Het
Slc12a1 C A 2: 125,214,132 T861N probably benign Het
Slc35f1 T A 10: 53,089,414 S308R probably damaging Het
Slc35f4 T A 14: 49,298,898 I427F probably damaging Het
Slco4c1 T C 1: 96,837,520 T402A possibly damaging Het
Sprr2f G A 3: 92,365,944 V17M unknown Het
Stab1 T C 14: 31,159,259 T605A probably benign Het
Taar8c A C 10: 24,101,548 L122R probably damaging Het
Tbc1d2 G A 4: 46,649,965 P24S probably benign Het
Tex36 T C 7: 133,595,137 probably null Het
Tmem145 T C 7: 25,307,165 probably null Het
Ttn T G 2: 76,720,354 D31528A probably damaging Het
Vars2 A T 17: 35,666,686 V118E probably benign Het
Vmn1r195 T C 13: 22,278,852 V164A probably benign Het
Vmn2r69 T C 7: 85,411,259 I372M probably benign Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Wnt9b T C 11: 103,730,817 Q338R probably benign Het
Zfp128 A G 7: 12,890,362 D219G probably benign Het
Zfp541 A T 7: 16,092,868 R1181W probably damaging Het
Zfp867 C T 11: 59,463,934 G190S probably benign Het
Zfp971 T A 2: 178,033,174 C189S probably damaging Het
Other mutations in Nup205
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Nup205 APN 6 35214802 missense probably damaging 1.00
IGL01086:Nup205 APN 6 35208936 splice site probably benign
IGL01138:Nup205 APN 6 35208084 nonsense probably null
IGL01333:Nup205 APN 6 35241063 missense probably benign
IGL01399:Nup205 APN 6 35219689 missense possibly damaging 0.80
IGL01466:Nup205 APN 6 35199959 missense probably benign 0.08
IGL01913:Nup205 APN 6 35227430 missense probably benign 0.10
IGL02159:Nup205 APN 6 35189178 missense probably damaging 1.00
IGL02442:Nup205 APN 6 35190068 missense probably benign 0.01
IGL02447:Nup205 APN 6 35227576 splice site probably null
IGL02558:Nup205 APN 6 35189924 missense probably damaging 1.00
IGL03306:Nup205 APN 6 35208169 missense probably damaging 0.98
IGL03328:Nup205 APN 6 35232414 missense probably damaging 0.99
Figaro UTSW 6 35196714 splice site probably null
Marcellina UTSW 6 35183969 missense probably damaging 1.00
Spirit UTSW 6 35232408 missense probably damaging 0.98
Susanna UTSW 6 35208109 missense possibly damaging 0.94
voyager UTSW 6 35189885 missense possibly damaging 0.80
BB007:Nup205 UTSW 6 35194576 missense probably damaging 0.98
BB017:Nup205 UTSW 6 35194576 missense probably damaging 0.98
P0012:Nup205 UTSW 6 35196543 missense possibly damaging 0.90
R0102:Nup205 UTSW 6 35225780 splice site probably benign
R0102:Nup205 UTSW 6 35225780 splice site probably benign
R0362:Nup205 UTSW 6 35196714 splice site probably null
R0374:Nup205 UTSW 6 35208837 missense probably damaging 1.00
R0415:Nup205 UTSW 6 35214634 splice site probably benign
R0427:Nup205 UTSW 6 35194463 missense probably benign 0.01
R0543:Nup205 UTSW 6 35198969 missense probably benign
R0611:Nup205 UTSW 6 35225968 missense probably null 1.00
R0761:Nup205 UTSW 6 35196428 splice site probably benign
R0828:Nup205 UTSW 6 35194566 missense probably benign
R0906:Nup205 UTSW 6 35236892 missense probably damaging 1.00
R1023:Nup205 UTSW 6 35234706 missense probably damaging 0.98
R1033:Nup205 UTSW 6 35227442 missense probably benign
R1375:Nup205 UTSW 6 35200071 splice site probably benign
R1447:Nup205 UTSW 6 35215185 missense probably benign 0.00
R1468:Nup205 UTSW 6 35225982 critical splice donor site probably null
R1468:Nup205 UTSW 6 35225982 critical splice donor site probably null
R1625:Nup205 UTSW 6 35191943 missense probably benign 0.31
R1652:Nup205 UTSW 6 35238966 missense probably benign
R1659:Nup205 UTSW 6 35234788 missense probably benign 0.02
R1693:Nup205 UTSW 6 35210971 missense probably benign 0.05
R1769:Nup205 UTSW 6 35205431 missense probably damaging 1.00
R1839:Nup205 UTSW 6 35219714 missense probably benign 0.00
R1959:Nup205 UTSW 6 35233366 missense probably benign 0.16
R2051:Nup205 UTSW 6 35230516 missense probably benign 0.29
R2267:Nup205 UTSW 6 35241349 missense possibly damaging 0.67
R2401:Nup205 UTSW 6 35208134 nonsense probably null
R3697:Nup205 UTSW 6 35188711 missense probably benign 0.15
R3938:Nup205 UTSW 6 35219742 missense probably damaging 1.00
R4074:Nup205 UTSW 6 35192040 critical splice donor site probably null
R4117:Nup205 UTSW 6 35241012 nonsense probably null
R4364:Nup205 UTSW 6 35192027 missense probably benign 0.38
R4366:Nup205 UTSW 6 35192027 missense probably benign 0.38
R4594:Nup205 UTSW 6 35196489 missense probably benign 0.00
R4706:Nup205 UTSW 6 35202008 missense probably damaging 1.00
R4787:Nup205 UTSW 6 35202061 missense probably damaging 1.00
R4849:Nup205 UTSW 6 35230570 missense possibly damaging 0.90
R4850:Nup205 UTSW 6 35230530 missense probably benign 0.16
R4943:Nup205 UTSW 6 35224639 missense probably damaging 1.00
R4966:Nup205 UTSW 6 35243849 missense probably benign 0.00
R5138:Nup205 UTSW 6 35225866 missense probably damaging 1.00
R5251:Nup205 UTSW 6 35196482 splice site probably null
R5444:Nup205 UTSW 6 35189189 missense probably damaging 0.98
R5760:Nup205 UTSW 6 35247343 missense probably damaging 1.00
R5762:Nup205 UTSW 6 35227680 missense probably damaging 1.00
R5762:Nup205 UTSW 6 35230548 missense probably damaging 0.96
R5941:Nup205 UTSW 6 35232408 missense probably damaging 0.98
R5969:Nup205 UTSW 6 35177578 unclassified probably benign
R6003:Nup205 UTSW 6 35212816 missense probably benign
R6178:Nup205 UTSW 6 35243843 missense possibly damaging 0.85
R6315:Nup205 UTSW 6 35236869 missense probably damaging 1.00
R6392:Nup205 UTSW 6 35189885 missense possibly damaging 0.80
R6710:Nup205 UTSW 6 35247373 missense probably benign 0.00
R6954:Nup205 UTSW 6 35208109 missense possibly damaging 0.94
R7022:Nup205 UTSW 6 35243936 missense probably benign 0.45
R7041:Nup205 UTSW 6 35224535 missense possibly damaging 0.49
R7052:Nup205 UTSW 6 35215142 missense possibly damaging 0.81
R7310:Nup205 UTSW 6 35225969 missense possibly damaging 0.78
R7363:Nup205 UTSW 6 35232573 missense probably benign 0.28
R7399:Nup205 UTSW 6 35214676 missense probably damaging 0.99
R7553:Nup205 UTSW 6 35201999 missense probably damaging 1.00
R7665:Nup205 UTSW 6 35177620 missense possibly damaging 0.46
R7841:Nup205 UTSW 6 35247437 missense unknown
R7930:Nup205 UTSW 6 35194576 missense probably damaging 0.98
R7973:Nup205 UTSW 6 35245339 missense probably benign
R7976:Nup205 UTSW 6 35198953 missense probably damaging 1.00
R8073:Nup205 UTSW 6 35202169 critical splice donor site probably null
R8080:Nup205 UTSW 6 35227376 missense probably damaging 1.00
R8118:Nup205 UTSW 6 35230516 missense probably benign 0.29
R8213:Nup205 UTSW 6 35225203 missense probably benign 0.26
R8237:Nup205 UTSW 6 35227503 missense possibly damaging 0.89
R8408:Nup205 UTSW 6 35225247 missense probably damaging 1.00
R8807:Nup205 UTSW 6 35183969 missense probably damaging 1.00
R8812:Nup205 UTSW 6 35214334 missense probably damaging 1.00
R9061:Nup205 UTSW 6 35219873 intron probably benign
R9261:Nup205 UTSW 6 35199857 missense probably benign 0.00
R9403:Nup205 UTSW 6 35199974 missense probably benign 0.45
R9648:Nup205 UTSW 6 35225811 missense probably benign 0.00
R9744:Nup205 UTSW 6 35232575 missense probably damaging 0.99
R9800:Nup205 UTSW 6 35186533 missense possibly damaging 0.85
Z1177:Nup205 UTSW 6 35177605 missense unknown
Z1177:Nup205 UTSW 6 35208793 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCACCCTGACTGCTCACCTAAG -3'
(R):5'- TCTAGTGTGTCCGGCTCATC -3'

Sequencing Primer
(F):5'- TAAGCCAGGCTGTGCGC -3'
(R):5'- CATCTGGTCTCTGGGCAATCTG -3'
Posted On 2019-10-07