Mutagenetix > Incidental Mutations

Incidental Mutation 'R7428:Rfx4'

576261

Institutional Source

Beutler Lab

Gene Symbol

Rfx4

Ensembl Gene

ENSMUSG00000020037

Gene Name

regulatory factor X, 4 (influences HLA class II expression)

Synonyms

4933412G19Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7428 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

84756062-84906538 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 84896012 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 618 (Q618K)

Ref Sequence

ENSEMBL: ENSMUSP00000051107 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060397] [ENSMUST00000095388] [ENSMUST00000166696]

AlphaFold

Q7TNK1

Predicted Effect

probably benign
Transcript: ENSMUST00000060397
AA Change: Q618K

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000051107
Gene: ENSMUSG00000020037
AA Change: Q618K

Domain	Start	End	E-Value	Type
Pfam:RFX_DNA_binding	58	136	7.9e-37	PFAM
Blast:HisKA	293	356	5e-7	BLAST
low complexity region	503	515	N/A	INTRINSIC
low complexity region	521	537	N/A	INTRINSIC
low complexity region	599	611	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000095388
AA Change: Q524K

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000093035
Gene: ENSMUSG00000020037
AA Change: Q524K

Domain	Start	End	E-Value	Type
SCOP:d1kwha_	11	201	6e-3	SMART
Blast:HisKA	199	262	4e-7	BLAST
low complexity region	409	421	N/A	INTRINSIC
low complexity region	427	443	N/A	INTRINSIC
low complexity region	505	517	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000166696
AA Change: Q475K

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000128690
Gene: ENSMUSG00000020037
AA Change: Q475K

Domain	Start	End	E-Value	Type
Blast:HisKA	150	213	6e-7	BLAST
low complexity region	360	372	N/A	INTRINSIC
low complexity region	378	394	N/A	INTRINSIC
low complexity region	456	468	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X2, X3, and X5. It has been shown to interact with itself as well as with regulatory factors X2 and X3, but it does not interact with regulatory factor X1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2011]
PHENOTYPE: Inactivating null allele or homozygous point mutation alleles exhibit missing dorsal midline structure of the cortex including the subcommissural organ and neonatal lethality. Heterozygous null mice have congenital hydrocephalus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anxa10	T	A	8: 62,092,509	Y63F	probably benign	Het
Atl2	T	C	17: 79,875,798		probably null	Het
B3gnt4	A	G	5: 123,510,731	N53S	probably damaging	Het
Bpifb5	G	A	2: 154,225,122	M98I	probably benign	Het
Cacna2d3	A	G	14: 29,064,275	M585T	probably damaging	Het
Cbarp	T	C	10: 80,131,304	D701G	probably damaging	Het
Cep295	A	G	9: 15,333,498	S1221P	possibly damaging	Het
Cep350	T	C	1: 155,894,619	S1842G	probably benign	Het
Cntrl	T	A	2: 35,170,534	W1913R	probably benign	Het
Creb5	C	A	6: 53,681,158	Q158K	unknown	Het
Crtam	G	C	9: 40,981,182	A266G	probably benign	Het
Cry2	T	C	2: 92,413,047	D483G	possibly damaging	Het
Csmd1	A	G	8: 16,023,850	F2044L	possibly damaging	Het
Cxcr6	A	T	9: 123,810,240	Y109F	probably benign	Het
Cyb5b	A	G	8: 107,170,416	D106G	probably benign	Het
D630036H23Rik	T	C	12: 36,381,538	R154G	unknown	Het
Ddit4l	A	G	3: 137,626,170	E99G	probably damaging	Het
Dmbt1	A	T	7: 131,108,463	T1495S	possibly damaging	Het
Gm21886	A	T	18: 80,089,652	L97Q	probably damaging	Het
Hlcs	A	G	16: 94,267,899	V154A	probably benign	Het
Hpdl	A	T	4: 116,820,865	L133Q	probably damaging	Het
Inpp5f	A	G	7: 128,679,805	D510G	probably damaging	Het
Ism2	G	T	12: 87,286,995	T92K	possibly damaging	Het
Kif13b	T	C	14: 64,788,460	I1422T	probably benign	Het
Leng8	C	T	7: 4,143,573	R395W	probably damaging	Het
Mocs2	A	G	13: 114,820,864	I6V	probably benign	Het
Mthfr	A	G	4: 148,051,603	M378V	probably benign	Het
Myh13	A	G	11: 67,332,564	T237A	probably damaging	Het
Nr1h4	T	C	10: 89,498,405	E41G	probably benign	Het
Nup205	T	A	6: 35,227,559	I1460N	probably damaging	Het
Nup98	A	T	7: 102,135,001		probably null	Het
Nxpe5	A	C	5: 138,239,760	Y194S	probably damaging	Het
Olfr1024	T	A	2: 85,904,131	R308*	probably null	Het
Olfr1032	A	T	2: 86,008,219	I148L	probably benign	Het
Olfr1121	G	T	2: 87,371,690	V53L	probably benign	Het
Olfr466	A	G	13: 65,153,052	Y276C	probably damaging	Het
Olfr554	A	G	7: 102,640,326	I27V	probably benign	Het
Otof	G	T	5: 30,389,825	D383E	probably damaging	Het
Pcdh9	G	T	14: 93,887,111	T541K	probably damaging	Het
Pclo	A	T	5: 14,750,517	I1179F		Het
Pde6c	T	C	19: 38,157,536		probably null	Het
Pdia6	T	C	12: 17,278,545	V167A	probably damaging	Het
Phf7	C	T	14: 31,240,413	R145Q	possibly damaging	Het
Plxnb1	T	C	9: 109,108,168	V1139A	probably benign	Het
Prkg1	T	C	19: 30,578,835	I585M	probably damaging	Het
Prom2	A	G	2: 127,539,811	L195P	probably damaging	Het
Ptprd	G	A	4: 76,086,468	P17S	probably benign	Het
Rhobtb1	T	A	10: 69,248,824	I15N	probably damaging	Het
Sap30	C	T	8: 57,487,512	V19M	possibly damaging	Het
Scrib	G	A	15: 76,061,198	T721M	probably damaging	Het
Slc12a1	C	A	2: 125,214,132	T861N	probably benign	Het
Slc35f1	T	A	10: 53,089,414	S308R	probably damaging	Het
Slc35f4	T	A	14: 49,298,898	I427F	probably damaging	Het
Slco4c1	T	C	1: 96,837,520	T402A	possibly damaging	Het
Sprr2f	G	A	3: 92,365,944	V17M	unknown	Het
Stab1	T	C	14: 31,159,259	T605A	probably benign	Het
Taar8c	A	C	10: 24,101,548	L122R	probably damaging	Het
Tbc1d2	G	A	4: 46,649,965	P24S	probably benign	Het
Tex36	T	C	7: 133,595,137		probably null	Het
Tmem145	T	C	7: 25,307,165		probably null	Het
Ttn	T	G	2: 76,720,354	D31528A	probably damaging	Het
Vars2	A	T	17: 35,666,686	V118E	probably benign	Het
Vmn1r195	T	C	13: 22,278,852	V164A	probably benign	Het
Vmn2r69	T	C	7: 85,411,259	I372M	probably benign	Het
Vmn2r93	A	T	17: 18,326,410	H848L	probably benign	Het
Wnt9b	T	C	11: 103,730,817	Q338R	probably benign	Het
Zfp128	A	G	7: 12,890,362	D219G	probably benign	Het
Zfp541	A	T	7: 16,092,868	R1181W	probably damaging	Het
Zfp867	C	T	11: 59,463,934	G190S	probably benign	Het
Zfp971	T	A	2: 178,033,174	C189S	probably damaging	Het

Other mutations in Rfx4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Rfx4	APN	10	84840199	missense	probably damaging	1.00
IGL00334:Rfx4	APN	10	84780053	missense	possibly damaging	0.91
IGL00928:Rfx4	APN	10	84840114	missense	probably benign	0.04
IGL01063:Rfx4	APN	10	84868382	missense	possibly damaging	0.90
IGL01490:Rfx4	APN	10	84840851	missense	possibly damaging	0.85
IGL02390:Rfx4	APN	10	84840150	missense	probably damaging	1.00
IGL02454:Rfx4	APN	10	84840106	missense	possibly damaging	0.83
R0099:Rfx4	UTSW	10	84894304	missense	probably benign
R0503:Rfx4	UTSW	10	84894332	missense	possibly damaging	0.56
R0924:Rfx4	UTSW	10	84868427	missense	probably damaging	1.00
R0930:Rfx4	UTSW	10	84868427	missense	probably damaging	1.00
R1386:Rfx4	UTSW	10	84863285	missense	probably damaging	1.00
R1715:Rfx4	UTSW	10	84844280	missense	probably damaging	1.00
R1738:Rfx4	UTSW	10	84880975	critical splice donor site	probably null
R1987:Rfx4	UTSW	10	84896088	missense	possibly damaging	0.87
R3717:Rfx4	UTSW	10	84880224	missense	probably damaging	1.00
R4231:Rfx4	UTSW	10	84814694	missense	probably benign	0.03
R4300:Rfx4	UTSW	10	84905102	missense	probably damaging	0.98
R4581:Rfx4	UTSW	10	84844300	missense	possibly damaging	0.93
R4582:Rfx4	UTSW	10	84844300	missense	possibly damaging	0.93
R4618:Rfx4	UTSW	10	84880896	missense	probably benign	0.01
R5156:Rfx4	UTSW	10	84868354	missense	probably damaging	1.00
R5185:Rfx4	UTSW	10	84863250	missense	probably damaging	1.00
R5377:Rfx4	UTSW	10	84860542	missense	possibly damaging	0.81
R5601:Rfx4	UTSW	10	84798578	missense	probably damaging	1.00
R5879:Rfx4	UTSW	10	84814761	critical splice donor site	probably null
R5996:Rfx4	UTSW	10	84840017	nonsense	probably null
R6358:Rfx4	UTSW	10	84844235	missense	probably damaging	1.00
R6805:Rfx4	UTSW	10	84840228	missense	possibly damaging	0.86
R7248:Rfx4	UTSW	10	84905055	missense	probably benign	0.05
R7427:Rfx4	UTSW	10	84896012	missense	probably benign	0.28
R7514:Rfx4	UTSW	10	84880226	missense	probably damaging	1.00
R7576:Rfx4	UTSW	10	84863349	missense	probably damaging	0.98
R8002:Rfx4	UTSW	10	84840857	missense	probably damaging	0.97
R8838:Rfx4	UTSW	10	84840894	missense	probably damaging	1.00
R8938:Rfx4	UTSW	10	84840072	missense	probably damaging	1.00
R9359:Rfx4	UTSW	10	84905057	missense	probably benign	0.00
RF010:Rfx4	UTSW	10	84858487	critical splice acceptor site	probably benign
RF014:Rfx4	UTSW	10	84858489	critical splice acceptor site	probably benign
RF015:Rfx4	UTSW	10	84858489	critical splice acceptor site	probably benign
RF023:Rfx4	UTSW	10	84858485	critical splice acceptor site	probably benign
RF030:Rfx4	UTSW	10	84858480	critical splice acceptor site	probably benign
RF035:Rfx4	UTSW	10	84858480	critical splice acceptor site	probably benign
RF046:Rfx4	UTSW	10	84858481	critical splice acceptor site	probably benign
RF060:Rfx4	UTSW	10	84858494	critical splice acceptor site	probably benign
RF062:Rfx4	UTSW	10	84858481	critical splice acceptor site	probably benign
X0024:Rfx4	UTSW	10	84780074	missense	possibly damaging	0.82
Z1177:Rfx4	UTSW	10	84814684	missense	possibly damaging	0.85
Z1177:Rfx4	UTSW	10	84896091	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- GGGTTTTAAAGCTCACCACAGC -3'
(R):5'- ACAGCGGACTTATTAACTGTGGG -3'

Sequencing Primer
(F):5'- TTTTAAAGCTCACCACAGCAAGGC -3'
(R):5'- ACTTATTAACTGTGGGTAGTTGGC -3'

Posted On

2019-10-07