Incidental Mutation 'R7428:Myh13'
ID576264
Institutional Source Beutler Lab
Gene Symbol Myh13
Ensembl Gene ENSMUSG00000060180
Gene Namemyosin, heavy polypeptide 13, skeletal muscle
SynonymsEO Myosin, extraocular myosin, MyHC-eo
MMRRC Submission
Accession Numbers

Genbank: NM_001081250; MGI: 1339967

Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R7428 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location67321658-67371586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67332564 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 237 (T237A)
Ref Sequence ENSEMBL: ENSMUSP00000080584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081911] [ENSMUST00000108684] [ENSMUST00000180845]
Predicted Effect probably damaging
Transcript: ENSMUST00000081911
AA Change: T237A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080584
Gene: ENSMUSG00000060180
AA Change: T237A

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 8e-13 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
Pfam:Myosin_tail_1 847 1928 4.6e-159 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108684
AA Change: T237A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104324
Gene: ENSMUSG00000060180
AA Change: T237A

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000180845
AA Change: T237A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137731
Gene: ENSMUSG00000060180
AA Change: T237A

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Meta Mutation Damage Score 0.5386 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (71/71)
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa10 T A 8: 62,092,509 Y63F probably benign Het
Atl2 T C 17: 79,875,798 probably null Het
B3gnt4 A G 5: 123,510,731 N53S probably damaging Het
Bpifb5 G A 2: 154,225,122 M98I probably benign Het
Cacna2d3 A G 14: 29,064,275 M585T probably damaging Het
Cbarp T C 10: 80,131,304 D701G probably damaging Het
Cep295 A G 9: 15,333,498 S1221P possibly damaging Het
Cep350 T C 1: 155,894,619 S1842G probably benign Het
Cntrl T A 2: 35,170,534 W1913R probably benign Het
Creb5 C A 6: 53,681,158 Q158K unknown Het
Crtam G C 9: 40,981,182 A266G probably benign Het
Cry2 T C 2: 92,413,047 D483G possibly damaging Het
Csmd1 A G 8: 16,023,850 F2044L possibly damaging Het
Cxcr6 A T 9: 123,810,240 Y109F probably benign Het
Cyb5b A G 8: 107,170,416 D106G probably benign Het
D630036H23Rik T C 12: 36,381,538 R154G unknown Het
Ddit4l A G 3: 137,626,170 E99G probably damaging Het
Dmbt1 A T 7: 131,108,463 T1495S possibly damaging Het
Gm21886 A T 18: 80,089,652 L97Q probably damaging Het
Hlcs A G 16: 94,267,899 V154A probably benign Het
Hpdl A T 4: 116,820,865 L133Q probably damaging Het
Inpp5f A G 7: 128,679,805 D510G probably damaging Het
Ism2 G T 12: 87,286,995 T92K possibly damaging Het
Kif13b T C 14: 64,788,460 I1422T probably benign Het
Leng8 C T 7: 4,143,573 R395W probably damaging Het
Mocs2 A G 13: 114,820,864 I6V probably benign Het
Mthfr A G 4: 148,051,603 M378V probably benign Het
Nr1h4 T C 10: 89,498,405 E41G probably benign Het
Nup205 T A 6: 35,227,559 I1460N probably damaging Het
Nup98 A T 7: 102,135,001 probably null Het
Nxpe5 A C 5: 138,239,760 Y194S probably damaging Het
Olfr1024 T A 2: 85,904,131 R308* probably null Het
Olfr1032 A T 2: 86,008,219 I148L probably benign Het
Olfr1121 G T 2: 87,371,690 V53L probably benign Het
Olfr466 A G 13: 65,153,052 Y276C probably damaging Het
Olfr554 A G 7: 102,640,326 I27V probably benign Het
Otof G T 5: 30,389,825 D383E probably damaging Het
Pcdh9 G T 14: 93,887,111 T541K probably damaging Het
Pclo A T 5: 14,750,517 I1179F Het
Pde6c T C 19: 38,157,536 probably null Het
Pdia6 T C 12: 17,278,545 V167A probably damaging Het
Phf7 C T 14: 31,240,413 R145Q possibly damaging Het
Plxnb1 T C 9: 109,108,168 V1139A probably benign Het
Prkg1 T C 19: 30,578,835 I585M probably damaging Het
Prom2 A G 2: 127,539,811 L195P probably damaging Het
Ptprd G A 4: 76,086,468 P17S probably benign Het
Rfx4 C A 10: 84,896,012 Q618K probably benign Het
Rhobtb1 T A 10: 69,248,824 I15N probably damaging Het
Sap30 C T 8: 57,487,512 V19M possibly damaging Het
Scrib G A 15: 76,061,198 T721M probably damaging Het
Slc12a1 C A 2: 125,214,132 T861N probably benign Het
Slc35f1 T A 10: 53,089,414 S308R probably damaging Het
Slc35f4 T A 14: 49,298,898 I427F probably damaging Het
Slco4c1 T C 1: 96,837,520 T402A possibly damaging Het
Sprr2f G A 3: 92,365,944 V17M unknown Het
Stab1 T C 14: 31,159,259 T605A probably benign Het
Taar8c A C 10: 24,101,548 L122R probably damaging Het
Tbc1d2 G A 4: 46,649,965 P24S probably benign Het
Tex36 T C 7: 133,595,137 probably null Het
Tmem145 T C 7: 25,307,165 probably null Het
Ttn T G 2: 76,720,354 D31528A probably damaging Het
Vars2 A T 17: 35,666,686 V118E probably benign Het
Vmn1r195 T C 13: 22,278,852 V164A probably benign Het
Vmn2r69 T C 7: 85,411,259 I372M probably benign Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Wnt9b T C 11: 103,730,817 Q338R probably benign Het
Zfp128 A G 7: 12,890,362 D219G probably benign Het
Zfp541 A T 7: 16,092,868 R1181W probably damaging Het
Zfp867 C T 11: 59,463,934 G190S probably benign Het
Zfp971 T A 2: 178,033,174 C189S probably damaging Het
Other mutations in Myh13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Myh13 APN 11 67342488 missense probably damaging 1.00
IGL00808:Myh13 APN 11 67335004 critical splice donor site probably null
IGL00822:Myh13 APN 11 67361328 missense probably damaging 0.98
IGL00823:Myh13 APN 11 67355947 missense probably benign 0.00
IGL00945:Myh13 APN 11 67348006 missense probably null 1.00
IGL01414:Myh13 APN 11 67342472 missense probably benign 0.02
IGL01482:Myh13 APN 11 67352068 missense probably benign
IGL01523:Myh13 APN 11 67347943 missense possibly damaging 0.73
IGL01723:Myh13 APN 11 67369219 unclassified probably benign
IGL01997:Myh13 APN 11 67367166 missense probably benign 0.14
IGL02369:Myh13 APN 11 67360274 unclassified probably benign
IGL02478:Myh13 APN 11 67369378 missense probably benign
IGL02663:Myh13 APN 11 67354927 nonsense probably null
IGL02851:Myh13 APN 11 67348916 missense possibly damaging 0.92
IGL02863:Myh13 APN 11 67332541 missense probably damaging 1.00
IGL02929:Myh13 APN 11 67367165 missense probably damaging 1.00
IGL02979:Myh13 APN 11 67334962 missense possibly damaging 0.72
IGL03065:Myh13 APN 11 67344853 missense probably damaging 0.99
IGL03214:Myh13 APN 11 67353585 missense possibly damaging 0.79
IGL03223:Myh13 APN 11 67350242 missense probably benign 0.39
IGL03231:Myh13 APN 11 67351991 missense possibly damaging 0.94
IGL03407:Myh13 APN 11 67352152 missense probably damaging 1.00
3-1:Myh13 UTSW 11 67351951 splice site probably benign
P0042:Myh13 UTSW 11 67334991 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0379:Myh13 UTSW 11 67369295 unclassified probably benign
R0496:Myh13 UTSW 11 67348815 missense probably damaging 1.00
R0584:Myh13 UTSW 11 67360374 nonsense probably null
R0595:Myh13 UTSW 11 67344846 missense probably benign 0.03
R0621:Myh13 UTSW 11 67341232 missense probably damaging 0.98
R0834:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R0893:Myh13 UTSW 11 67334601 missense probably damaging 1.00
R0964:Myh13 UTSW 11 67345002 missense probably benign 0.02
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0974:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R1028:Myh13 UTSW 11 67356181 missense possibly damaging 0.71
R1112:Myh13 UTSW 11 67354750 missense probably damaging 1.00
R1283:Myh13 UTSW 11 67370921 missense probably damaging 1.00
R1288:Myh13 UTSW 11 67353718 missense probably benign 0.00
R1386:Myh13 UTSW 11 67370950 missense possibly damaging 0.79
R1457:Myh13 UTSW 11 67331046 missense probably damaging 0.97
R1503:Myh13 UTSW 11 67353674 missense probably benign 0.43
R1574:Myh13 UTSW 11 67362581 unclassified probably benign
R1673:Myh13 UTSW 11 67352119 missense possibly damaging 0.79
R1693:Myh13 UTSW 11 67341484 missense possibly damaging 0.95
R1763:Myh13 UTSW 11 67334576 missense probably benign
R2029:Myh13 UTSW 11 67361289 missense probably benign 0.03
R2030:Myh13 UTSW 11 67350238 missense probably benign
R2247:Myh13 UTSW 11 67334558 missense probably damaging 0.96
R2393:Myh13 UTSW 11 67340358 missense possibly damaging 0.93
R2395:Myh13 UTSW 11 67364922 missense probably benign 0.12
R2884:Myh13 UTSW 11 67337643 missense probably benign 0.27
R3696:Myh13 UTSW 11 67345044 missense possibly damaging 0.55
R3786:Myh13 UTSW 11 67327188 missense probably benign 0.01
R3875:Myh13 UTSW 11 67358194 missense probably benign 0.26
R3918:Myh13 UTSW 11 67329238 missense probably benign 0.00
R4061:Myh13 UTSW 11 67330889 missense possibly damaging 0.71
R4160:Myh13 UTSW 11 67364810 intron probably benign
R4183:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R4392:Myh13 UTSW 11 67344881 splice site probably null
R4639:Myh13 UTSW 11 67341551 missense possibly damaging 0.91
R4670:Myh13 UTSW 11 67364738 nonsense probably null
R4783:Myh13 UTSW 11 67341270 missense probably damaging 1.00
R4877:Myh13 UTSW 11 67337651 missense probably damaging 0.99
R5250:Myh13 UTSW 11 67327259 nonsense probably null
R5278:Myh13 UTSW 11 67334564 missense probably benign 0.00
R5371:Myh13 UTSW 11 67344790 splice site probably null
R5479:Myh13 UTSW 11 67348822 missense probably damaging 0.97
R5510:Myh13 UTSW 11 67337723 missense probably benign 0.05
R5690:Myh13 UTSW 11 67329275 missense probably damaging 1.00
R5797:Myh13 UTSW 11 67335002 missense possibly damaging 0.66
R5823:Myh13 UTSW 11 67360468 missense probably damaging 1.00
R5877:Myh13 UTSW 11 67353658 missense possibly damaging 0.78
R6041:Myh13 UTSW 11 67364730 missense probably damaging 1.00
R6175:Myh13 UTSW 11 67354762 missense probably benign 0.00
R6244:Myh13 UTSW 11 67362501 missense probably benign 0.00
R6454:Myh13 UTSW 11 67350365 missense probably benign 0.03
R6617:Myh13 UTSW 11 67361400 missense probably benign 0.00
R6707:Myh13 UTSW 11 67350260 missense probably damaging 1.00
R6747:Myh13 UTSW 11 67350419 missense probably damaging 0.99
R6823:Myh13 UTSW 11 67356158 missense probably benign
R6911:Myh13 UTSW 11 67354927 nonsense probably null
R6997:Myh13 UTSW 11 67327154 nonsense probably null
R7033:Myh13 UTSW 11 67369316 missense possibly damaging 0.92
R7145:Myh13 UTSW 11 67354740 missense probably benign 0.08
R7232:Myh13 UTSW 11 67348846 missense probably damaging 1.00
R7448:Myh13 UTSW 11 67364460 critical splice acceptor site probably null
R7474:Myh13 UTSW 11 67327164 missense possibly damaging 0.93
R7474:Myh13 UTSW 11 67367711 missense
R7766:Myh13 UTSW 11 67358329 missense probably benign 0.37
R7809:Myh13 UTSW 11 67350341 missense probably benign 0.14
R7813:Myh13 UTSW 11 67327230 missense probably benign 0.27
R7953:Myh13 UTSW 11 67340380 missense probably damaging 1.00
R8085:Myh13 UTSW 11 67334787 missense probably benign 0.00
R8397:Myh13 UTSW 11 67350287 missense possibly damaging 0.62
R8434:Myh13 UTSW 11 67363185 critical splice acceptor site probably null
Z1176:Myh13 UTSW 11 67329295 missense possibly damaging 0.93
Z1177:Myh13 UTSW 11 67350452 missense possibly damaging 0.55
Z1177:Myh13 UTSW 11 67364591 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGTGATATCCCTCTTAGGACTCTG -3'
(R):5'- GGGGTGTTCACTAGCTAAAGGG -3'

Sequencing Primer
(F):5'- GCCCAGAGCACGCAGTTTC -3'
(R):5'- GTTGGGAGTTGAAAACCCA -3'
Posted On2019-10-07